cotI
168
outer spore coat protein
locus
BSU_30920
Molecular weight
41.09 kDa
pI
4.99
function
spore envelope
product
outer spore coat protein
essential
no
synonyms
cotI, ytaA
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG5881 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
3,162,084 → 3,163,157
The protein
Protein family
cotS family (with [protein|DC99E507696A1CB23140A1CBA45DA07D1F7C7D53|cotS] and [protein|0F40291BB10DB6D7DFD94B9C7D700F4410C4EE69|yutH], according to UniProt)
Structure
[PDB|2Q83] [pubmed|20077512]
[AF|O34656]
[wiki|Localization]
outer spore coat [pubmed|28870294]
Expression and Regulation
Operons
genes
[gene|D57116C65FD11EF92FB5D2945B10A1D024AEFF22|cotI]
description
[Pubmed|12480901]
regulation
expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,12480901]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190,12480901], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Biological materials
Mutant
MGNA-A030 (ytaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/30 NBRP B. subtilis, Japan]
BKE30920 (Δ[gene|D57116C65FD11EF92FB5D2945B10A1D024AEFF22|cotI]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE30920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTACCTGTTTTACTC, downstream forward: _UP4_TAAGACCATCATTTCCCCCG
BKK30920 (Δ[gene|D57116C65FD11EF92FB5D2945B10A1D024AEFF22|cotI]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK30920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTACCTGTTTTACTC, downstream forward: _UP4_TAAGACCATCATTTCCCCCG
References
Page visits: 4453
Time of last update: 2025-10-25 19:49:56
Author of last update: Melvin.boenninger