tlrB

168

23S rRNA (guanine-N(1)-)-methyltransferase, confers resistance against the macrolide antibiotic tylosin (produced by Streptomyces fradiae)

Locus: BSU_39010

Molecular weight: 31.32 kDa

Isoelectric point: 8.13

Protein length: 282 aa

Gene length: 849 bp

Function: resistance against tylosin

Product: 23S rRNA (guanine-N(1)-)-methyltransferase

Essential: no

Synonyms: tlrB, yxjB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2226 (Galperin et al., 2021)

Gene

Coordinates: 4,004,288  4,005,136

The protein

Catalyzed reaction/ biological activity

• methylates G748 of 23S rRNA in the peptide exit tunnel PubMed

Protein family

• Methyltransferase superfamily (according to UniProt)

Structure

• 1P91 (PDB) (from E. coli, 31% identity) PubMed
• P42313 (AlphaFold)

Expression and Regulation

Operons

• Genes: tlrB

  Description: PubMed

  Regulatory mechanism

  • TlrBL: attenuation, PubMed, in tlrBL regulon

  Additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of yxjB PubMed

Biological materials

Mutant

• MGNA-B726 (yxjB::erm), available at the NBRP B. subtilis, Japan
• 1A995 ( yxjB::spec), PubMed, available at BGSC
• BKE39010 (tlrB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGATAAAAAACACCCCAT,  downstream forward: _UP4_TGAATGGTAGAGGAAAGCTC
• BKK39010 (tlrB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGATAAAAAACACCCCAT,  downstream forward: _UP4_TGAATGGTAGAGGAAAGCTC

References

Loading