yqgQ

yqgQ
168

putative single-stranded nucleic acid binding protein

locus
BSU_24860
Molecular weight
8.48 kDa
pI
5.14
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yqgQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4483 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,571,582 → 2,571,797
The protein
Structure
[PDB|2NN4] [Pubmed|20057058]
[AF|P54494]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Biological materials
Mutant
BKE24860 (Δ[gene|CC0467F20FD53BD5291387CFAA8D79171C246D1F|yqgQ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTCACCATTTCTT,  downstream forward: _UP4_TTTTATAAAGGCTAAGGTGA
BKK24860 (Δ[gene|CC0467F20FD53BD5291387CFAA8D79171C246D1F|yqgQ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTCACCATTTCTT,  downstream forward: _UP4_TTTTATAAAGGCTAAGGTGA
References
15050034,20057058,38346457

CC0467F20FD53BD5291387CFAA8D79171C246D1F

Page visits: 2373

Time of last update: 2025-10-23 23:28:51

Author of last update: Jstuelk