sqhC
168
squalene-hopene cyclase, biosynthesis of sporulenes, protection of the spore against oxidative stress
locus
BSU_19320
Molecular weight
71.05 kDa
pI
7.63
function
biosynthesis of sporulenes
product
squalene-hopene cyclase
essential
no
synonyms
sqhC
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG1657 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
2,102,168 2,104,066
The protein
Catalyzed reaction/ biological activity
sporulenol --> H2O + tetraprenyl-β-curcumene (according to UniProt)
production of sporulenes, polycyclic terpenoid lipids [Pubmed|18436644]
protection of the spore against oxidative stress [Pubmed|18436644]
Protein family
terpene cyclase/mutase family (single member, according to UniProt)
Structure
[PDB|2SQC] (from Alicyclobacillus acidocaldarius, 32% identity) [pubmed|9931258]
[AF|Q796C3]
[wiki|Localization]
surrounds the forespores [Pubmed|18436644]
Expression and Regulation
Operons
genes
[gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]-[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]
description
[Pubmed|18436644]
regulation
expressed during sporulation in the mother cell [Pubmed|18436644]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,18436644], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Biological materials
Mutant
BKE19320 ([gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTCAACTCCTTCA, downstream forward: _UP4_GATTCTATTGAAAAGGAGAC
BKK19320 ([gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTCAACTCCTTCA, downstream forward: _UP4_GATTCTATTGAAAAGGAGAC
References
Page visits: 3442
Time of last update: 2025-10-26 02:22:33
Author of last update: Melvin.boenninger