ktrC

168

glutamate-controlled potassium channel KtrC-KtrD, peripheric membrane component

Locus: BSU_14510

Molecular weight: 24.20 kDa

Isoelectric point: 5.63

Protein length: 221 aa

Gene length: 666 bp

Function: potassium uptake

Product: glutamate-controlled potassium channel KtrC-KtrD, peripheric membrane component

Essential: no

Synonyms: ktrC, ylxV, yzaC, ykqB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0569 (Galperin et al., 2021)

Gene

Coordinates: 1,520,531  1,521,196

Phenotypes of a mutant

• inactivation of ktrC facilitates the adaptation a strain lacking c-di-AMP to growth on medium containing glutamate PubMed
• inactivation of ktrC facilitates the adaptation a strain lacking c-di-AMP to growth on complex medium under anaerobic conditions PubMed

The protein

Protein family

• KtrA potassium transport family (with KtrA, according to UniProt)

Domains

• contains a RCK_N domain at the N-terminus (aa 4-126)(according to UniProt)
• contains a c-di-AMP-binding RCK_C domain at the C-terminus (aa 135-219) (according to UniProt) PubMed

Structure

• 4J7C (PDB) (the KtrA-KtrB complex, 56% identity) PubMed
• 6I8V (PDB) (KtrC in complex with ATP) PubMed
• 4XTT (PDB) (the S. aureus KtrA RCK_C domain in complex with c-di-AMP, 57% identity) PubMed
• P39760 (AlphaFold)

Effectors of protein activity

• binds ADP and ATP PubMed
• the protein binds c-di-AMP, K_D = 30 nM, this results in inhibition of potassium uptake PubMed
• the affinity of KtrC-KtrD for potassium is strongly increased in the presence of glutamate PubMed

Kinetic information

• the KtrC-KtrD channel has a low affinity for potassium, this is determined by KtrD PubMed
• the affinity of KtrC-KtrD for potassium is strongly increased in the presence of glutamate (from 0.278 mM to 0.17 mM) PubMed

Paralogous protein(s)

• KtrA

Localization

• peripheral membrane protein PubMed

Expression and Regulation

Operons

• Genes: ktrC

  Description: PubMed

  Regulation

  • constitutively expressed PubMed

• Genes: kinC-ykqA-ktrC

  Description: PubMed

  Regulation

  • constitutively expressed PubMed

  Regulatory mechanism

  • Spo0A: activation, PubMed, in spo0A regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• MGNA-A904 (ykqB::erm), available at the NBRP B. subtilis, Japan
• GHB6 (ktrC::spec), PubMed (available in Erhard Bremer's and Jörg Stülke's) labs, available at BGSC as 1A955
• GP2264 (ΔktrC::aphA3), available in Jörg Stülke's lab PubMed
• GP2048 (ΔktrC'::cat), available in Jörg Stülke's lab PubMed
• GP2079 (ΔktrC::tet), available in Jörg Stülke's lab PubMed
• GP2771 (ΔktrC::spec), available in Jörg Stülke's lab
• GP2083 (ktrA-ktrB::aphA3 ktrC::tet), available in Jörg Stülke's lab PubMed
• BKE14510 (ktrC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA,  downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
• BKK14510 (ktrC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA,  downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC

Expression vectors

• pGP2907 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab
• pGP2994: expression of Strep-ktrC by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP2995: expression of ktrC-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Labs working on this gene/protein

• Erhard Bremer, University of Marburg, Germany Homepage
• Inga Hänelt, Frankfurt, Germany Homepage
• João H Morais-Cabral, University of Porto, Portugal Homepage
• Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Loading

Original Publications

Loading