rasP

168

intramembrane protease, cleaves FtsL, RsiV, RsgI and RsiW as well as signal peptides after release of the secreted proteins

Locus: BSU_16560

Molecular weight: 46.58 kDa

Isoelectric point: 5.14

Protein length: 422 aa

Gene length: 1269 bp

Function: control of cell division, and SigV and SigW activity

Product: intramembrane protease

Essential: no

Synonyms: rasP, yluC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0750 (Galperin et al., 2021)

Gene

Coordinates: 1,724,029 → 1,725,297

Phenotypes of a mutant

• defects in competence development, protein secretion and membrane protein production PubMed
• mutants grow slower in liquid, are not competent, can’t activate SigW, have cell division defects, and decreased long term survival PubMed
• inactivation of rasP reduces sporulation efficiency to 1.4% that of wild type cells; delayed entry into sporulation; thin, oblong forespores PubMed
• reduced protein secretion PubMed
• a cwlO rasP mutant is not viable, due to lack of expression of lytE PubMed
• ponA rasP double mutants have a growth defect that can be suppressed by reduced fatty acid synthesis (mutations in accA, accB, accC, accD or downregulation of the FapR regulon due to specific mutations in fapR) PubMed

The protein

Catalyzed reaction/ biological activity

• cleaves FtsL, RsiV and RsiW
• cleaves signal peptides after release  of the secreted proteins PubMed

Protein family

• peptidase M50B family (according to UniProt)

Domains

• 4 transmembrane helices (aa 6 - 26, 175 - 195, 346 - 366, 394 - 414) (according to UniProt)
• PDZ domain (aa 190 - 268) (according to UniProt)

Structure

• O31754 (AlphaFold)

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: ispC-rasP-proS-polC

  Description: PubMed

• Genes: uppS-cdsA-ispC-rasP-proS-polC

  Description: PubMed

Additional information

• expression is reduced in motile cells as compared to non-motile cells PubMed

Biological materials

Mutant

• BKE16560 (ΔrasP::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AACTGTATTCACGAACATAC,  downstream forward: _UP4_TAAACGAAAAGTAAATCAAT
• BKK16560 (ΔrasP::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AACTGTATTCACGAACATAC,  downstream forward: _UP4_TAAACGAAAAGTAAATCAAT

References

Reviews

Loading

Original Publications

Loading