floA

168

flottilin-like protein (in addition to FloT), reduces membrane order, resistence protein (against sublancin), accessory role in resistance to cefuroxime

Locus: BSU_25380

Molecular weight: 35.48 kDa

Isoelectric point: 4.92

Protein length: 331 aa

Gene length: 996 bp

Function: control of membrane fluidity

Product: flottilin-like protein

Essential: no

Synonyms: floA, yqfA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG4864 (Galperin et al., 2021)

Gene

Coordinates: 2,617,449  2,618,444

Phenotypes of a mutant

• reduced protein secretion PubMed
• a ''floT floA'' double mutant does not induce KinC-dependent biofilm formation upon addition of surfactin PubMed
• a ''floT floA'' double mutant has a strong synthetic defect in motility, cell morphology, and transformation efficiency PubMed
• a ''floT floA'' double mutant has a sporulation defect, due to the lack of FtsH PubMed
• a ''floA'' mutant produces increased amount of  pulcherriminic acid PubMed
• a ''floA'' mutant has reduced sensitivity to vancomycin PubMed

The protein

Catalyzed reaction/ biological activity

• controls protease activity of FtsH PubMed

Protein family

• Stomatin, Prohibitin, Flotillin, and HflK/C (SPFH) domain protein family (with YdjI and FloT) PubMed
• UPF0365 family (single member, according to UniProt)

Domains

• contains a SPFH domain (Stomatin, Prohibitin, Flotillin, and HflK/C-Domain) (aa 42 - 222) PubMed

Structure

• P54466 (AlphaFold)

Localization

• membrane PubMed
• co-localizes with FloT in discrete foci in the membrane PubMed
• forms focal structure in the cytoplasma membrane PubMed
• 13 foci FloA of are detected in strain 3610 PubMed

Expression and Regulation

Operons

• Genes: yqeZ-floA-yqfB

  Description: PubMed

  Regulation

  • expressed under stress conditions (SigW) PubMed

  Sigma factors

  • SigW: sigma factor, PubMed, in sigW regulon

Additional information

• the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• MGNA-C443 (yqfA::erm), available at the NBRP B. subtilis, Japan
• JS119 (3610 markerless), available in Daniel Lopez's lab
• DL1401 (168 floA::mls), available in Daniel Lopez's lab
• BKE25380 (floA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATAACTTCTCCTCGTTT,  downstream forward: _UP4_TAATCTCTCTAAGAAGGGAG
• BKK25380 (floA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATAACTTCTCCTCGTTT,  downstream forward: _UP4_TAATCTCTCTAAGAAGGGAG

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH) for FloA PubMed, available in Daniel Lopez's lab

GFP fusion

• GK192 (3610 lacA::PfloT-yfp(mls)), available in Daniel Lopez's lab
• JS136 (3610 amyE::floT-gfp(spc)), available in Daniel Lopez's lab
• JS134 (3610 lacA::floA-mEos2 (mls)), available in Daniel Lopez's lab
• JS167 (3610 lacA::floA-PAmCherry (mls)), available in Daniel Lopez's lab

References

Reviews

Loading

Original Publications

Loading