kinC

168

two-component sensor kinase, phosphorylates Spo0F and Spo0A, part of the phosphorelay, governs expression of genes involved in biofilm formation

Locus: BSU_14490

Molecular weight: 48.68 kDa

Isoelectric point: 6.22

Protein length: 428 aa

Gene length: 1287 bp

Function: initiation of sporulation

Product: two-component sensor kinase

Essential: no

Synonyms: kinC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG5807 (Galperin et al., 2021)

Gene

Coordinates: 1,518,333  1,519,619

Phenotypes of a mutant

• defective in biofilm formation PubMed

The protein

Catalyzed reaction/ biological activity

• autophosphorylation, phosphorylation and dephosphorylation of Spo0F as part of the phosphorelay PubMed
• direct phosphorylation of Spo0A PubMed
• mainly active in the younger, outer regions of a colony (with KinD) PubMed
• phosphorylates Spo0A in response to the presence of surfactin PubMed, this has been refuted PubMed
• required for initiation of sliding together with KinB PubMed

Domains

• two transmembrane segments
• PAS domain (aa 76-147) (according to UniProt)
• PAC domain (aa 148-22) (according to UniProt)
• Histidine kinase domain (aa 221-426) (according to UniProt)

Structure

• 3A0R (PDB) (HK-RR complex from Thermotoga maritima, 28% identity) PubMed
• P39764 (AlphaFold)

Modification

• autophosphorylation on a His residue

Effectors of protein activity

• activity is triggered by potassium leakage PubMed, this has been refuted PubMed
• activity is triggered by polyisoprenoid lipids formed by YisP PubMed
• activity is stimulated by the interaction with FloT PubMed

Localization

• cell membrane (Heterogeneous) PubMed
• co-localizes with FloT in discrete foci in the membrane PubMed
• the localization of KinC in membrane microdomains depends on FloA and FloT  PubMed, this has been refuted PubMed

Expression and Regulation

Operons

• Genes: kinC-ykqA-ktrC

  Description: PubMed

  Regulation

  • constitutively expressed PubMed

  Regulatory mechanism

  • Spo0A: activation, PubMed, in spo0A regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• 1A632 ( kinC::erm), PubMed, available at BGSC
• BAL393 (kinC::spc)PubMed
• BKE14490 (kinC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATGACCACCTGCCGCTT,  downstream forward: _UP4_GACAGCTGAGAGGAGAAAAA
• BKK14490 (kinC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATGACCACCTGCCGCTT,  downstream forward: _UP4_GACAGCTGAGAGGAGAAAAA

References

Reviews

Loading

Original Publications

Loading