kinD

168

osmo-sensing two-component sensor kinase, phosphorylates Spo0F, part of the phosphorelay, checkpoint protein that links sporulation initiation to biofilm formation

Locus: BSU_13660

Molecular weight: 56.54 kDa

Isoelectric point: 6.74

Protein length: 506 aa

Gene length: 1521 bp

Function: initiation of sporulation

Product: two-component sensor kinase

Essential: no

Synonyms: kinD, ykvD

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG5808 (Galperin et al., 2021)

Gene

Coordinates: 1,431,486  1,433,006

Phenotypes of a mutant

• deletion of kinD suppresses the sporulation defect of matrix mutants, while its overproduction delays sporulation PubMed
• inactivation of ''kinD restores beta-lactam resistance in a sigM'' mutant PubMed

The protein

Catalyzed reaction/ biological activity

• autophosphorylation, phosphorylation of Spo0F, regulates the onset of sporulation by inhibiting the activity of Spo0A until matrix, or a component therein, is sensed PubMed
• dual role as a phosphatase or a kinase, activity is linked to the presence of extracellular matrix in the biofilms PubMed
• mainly active in the younger, outer regions of a colony (with KinC) PubMed
• ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)

Domains

• two transmembrane segments, between them the extracellular pyruvate-binding sensing domain that consists of tandem PAS-like domains PubMed
• see PubMed for a scheme of the domain organization
• Histidine kinase domain (aa 298-505) (according to UniProt)

Structure

• 4DBJ (PDB) (extracytoplasmic sensing domain) PubMed
• O31671 (AlphaFold)

Modification

• autophosphorylation on a His residue

Effectors of protein activity

• activity is stimulated by direct or indirect interaction with Med PubMed
• may respond to the presence of extracellular glycerol bioRxiv
• L-malate seems to trigger KinD activity PubMed, but this effect may be indirect due to the excretion of pyruvate that directly binds the extracytoplasmic sensing domain of KinD PubMed
• kinase activity is triggered and phosphatase activity is decreased by increased osmotic pressure PubMed
• activity is triggered in the presence of glycerol + manganese PubMed

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: kinD

  Description: PubMed

Biological materials

Mutant

• MGNA-B323 (ykvD::erm), available at the NBRP B. subtilis, Japan
• BKE13660 (kinD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACACCTGATTAGAGGTA,  downstream forward: _UP4_TAGCCCCCCTGACCATGTCA
• BKK13660 (kinD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACACCTGATTAGAGGTA,  downstream forward: _UP4_TAGCCCCCCTGACCATGTCA

References

Loading