floT

168

membrane-associated scaffold protein, reduces membrane order, orchestration of physiological processes in lipid microdomains, involved in the control of membrane fluidity, confers (together with YuaF) resistance to cefuroxime

Locus: BSU_31010

Molecular weight: 55.82 kDa

Isoelectric point: 5.14

Protein length: 509 aa

Gene length: 1530 bp

Function: control of membrane fluidity

Product: membrane-associated scaffold protein

Essential: no

Synonyms: floT, yuaG, yuaH

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Membrane dynamics

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation, Other proteins required for biofilm formation

Lifestyles, Sporulation, Sporulation/ other

Lifestyles, Coping with stress, Cell envelope stress proteins (controlled by SigM, V, W, X, Y)

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG2268 (Galperin et al., 2021)

This gene is a member of the following regulons

SigW regulon

Gene

Coordinates: 3,180,465  3,181,994

Phenotypes of a mutant

delayed onset of sporulation, reduced sporulation frequency
defect in motility PubMed
reduced protein secretion PubMed
a ''floT floA'' double mutant does not induce KinC-dependent biofilm formation upon addition of surfactin PubMed
a ''floT floA'' double mutant has a strong synthetic defect in motility, cell morphology, and transformation efficiency PubMed
a ''floT floA'' double mutant has a sporulation defect, due to the lack of FtsH PubMed
a ''floT'' mutant displays a defective growth under oxygen-limiting conditions PubMed

The protein

Catalyzed reaction/ biological activity

SigW-dependent expression of ''fabF and the yuaF-floT-yuaI'' operon result in reduced membrane fluidity PubMed
recruits YuaF to focal assemblies  PubMed
controls protease activity of FtsH PubMed

Protein family

Stomatin, Prohibitin, Flotillin, and HflK/C (SPFH) domain protein family (with YdjI and FloA) PubMed

Domains

contains a SPFH domain (Stomatin, Prohibitin, Flotillin, and HflK/C-Domain) (aa 24 - 212) PubMed

Structure

O32076 (AlphaFold)

Localization

membrane associated PubMed
co-localizes with FloA and KinC in discrete foci membrane PubMed
forms discrete focal structures in the cytoplasma membrane PubMed
6 foci FloT of are detected in strain 3610 PubMed

Expression and Regulation

Operons

Genes: yuaF-floT-yuaI

Description: PubMed

Regulation

expressed upon cell wall stress (SigW) PubMed

Sigma factors

SigW: sigma factor, PubMed, in sigW regulon

Biological materials

Mutant

MGNA-A213 (yuaG::erm), available at the NBRP B. subtilis, Japan
JS152 (markerless), available in Daniel Lopez's lab
BKE31010 (floT::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCAAATTCCTCCTTTT,  downstream forward: _UP4_GAGTAAGGAAAGGGCAGAAC
BKK31010 (floT::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCAAATTCCTCCTTTT,  downstream forward: _UP4_GAGTAAGGAAAGGGCAGAAC

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH) for FloT PubMed, available in Daniel Lopez's lab

GFP fusion

GK38 (168 amyE::PfloT-yfp (spc)), available in Daniel Lopez's lab
JS280 (3610 amyE::floT-gfp(spc)), available in Daniel Lopez's lab
JS153 (3610 lacA::floT-mEos2 (mls)), available in Daniel Lopez's lab
JS166 (3610 lacA::floT-PAmCherry (mls)), available in Daniel Lopez's lab

References

Reviews

García-Heredia APlasma Membrane-Cell Wall Feedback in Bacteria.Journal of bacteriology. 2023 Feb 16; :e0043322. PMID: 36794934
Bramkamp M, Lopez D Exploring the existence of lipid rafts in bacteria. Microbiology and molecular biology reviews : MMBR. 2015 Mar; 79(1):81-100. doi:10.1128/MMBR.00036-14. PMID:25652542

Original Publications

Álvarez-Mena A, Morvan E, Martinez D, Berbon M, Savietto A, Grélard A, Turpin S, Dufourc EJ, Bramkamp M, Habenstein BBacterial flotillins as destabilizers of phospholipid membranes.Biochimica et biophysica acta. Biomembranes. 2024 Nov 7; :184399. PMID: 39521105
Zielińska A, Savietto A, de Sousa Borges A, Martinez D, Berbon M, Roelofsen JR, Hartman AM, de Boer R, Van der Klei IJ, Hirsch AK, Habenstein B, Bramkamp M, Scheffers DJFlotillin-mediated membrane fluidity controls peptidoglycan synthesis and MreB movement.eLife. 2020 Jul 14; 9. PMID: 32662773
Dempwolff F, Schmidt FK, Hervás AB, Stroh A, Rösch TC, Riese CN, Dersch S, Heimerl T, Lucena D, Hülsbusch N, Stuermer CA, Takeshita N, Fischer R, Eckhardt B, Graumann PL Super Resolution Fluorescence Microscopy and Tracking of Bacterial Flotillin (Reggie) Paralogs Provide Evidence for Defined-Sized Protein Microdomains within the Bacterial Membrane but Absence of Clusters Containing Detergent-Resistant Proteins. PLoS genetics. 2016 Jun; 12(6):e1006116. doi:10.1371/journal.pgen.1006116. PMID:27362352
Schneider J, Mielich-Süss B, Böhme R, Lopez D In vivo characterization of the scaffold activity of flotillin on the membrane kinase KinC of Bacillus subtilis. Microbiology (Reading, England). 2015 Sep; 161(9):1871-87. doi:10.1099/mic.0.000137. PMID:26297017
Schneider J, Klein T, Mielich-Süss B, Koch G, Franke C, Kuipers OP, Kovács ÁT, Sauer M, Lopez D Spatio-temporal remodeling of functional membrane microdomains organizes the signaling networks of a bacterium. PLoS genetics. 2015 Apr; 11(4):e1005140. doi:10.1371/journal.pgen.1005140. PMID:25909364
Bach JN, Bramkamp M Dissecting the molecular properties of prokaryotic flotillins. PloS one. 2015; 10(1):e0116750. doi:10.1371/journal.pone.0116750. PMID:25635948
Mielich-Süss B, Schneider J, Lopez D Overproduction of flotillin influences cell differentiation and shape in Bacillus subtilis. mBio. 2013 Nov 12; 4(6):e00719-13. doi:10.1128/mBio.00719-13. pii:e00719-13. PMID:24222488
Bach JN, Bramkamp M Flotillins functionally organize the bacterial membrane. Molecular microbiology. 2013 Jun; 88(6):1205-17. doi:10.1111/mmi.12252. PMID:23651456
Dempwolff F, Wischhusen HM, Specht M, Graumann PL The deletion of bacterial dynamin and flotillin genes results in pleiotrophic effects on cell division, cell growth and in cell shape maintenance. BMC microbiology. 2012 Dec 19; 12:298. doi:10.1186/1471-2180-12-298. PMID:23249255
Yepes A, Schneider J, Mielich B, Koch G, García-Betancur JC, Ramamurthi KS, Vlamakis H, López D The biofilm formation defect of a Bacillus subtilis flotillin-defective mutant involves the protease FtsH. Molecular microbiology. 2012 Oct; 86(2):457-71. doi:10.1111/j.1365-2958.2012.08205.x. PMID:22882210
Dempwolff F, Möller HM, Graumann PL Synthetic motility and cell shape defects associated with deletions of flotillin/reggie paralogs in Bacillus subtilis and interplay of these proteins with NfeD proteins. Journal of bacteriology. 2012 Sep; 194(17):4652-61. doi:10.1128/JB.00910-12. PMID:22753055
Lee YH, Kingston AW, Helmann JD Glutamate dehydrogenase affects resistance to cell wall antibiotics in Bacillus subtilis. Journal of bacteriology. 2012 Mar; 194(5):993-1001. doi:10.1128/JB.06547-11. PMID:22178969
López D, Kolter R Functional microdomains in bacterial membranes. Genes & development. 2010 Sep 01; 24(17):1893-902. doi:10.1101/gad.1945010. PMID:20713508
Donovan C, Bramkamp M Characterization and subcellular localization of a bacterial flotillin homologue. Microbiology (Reading, England). 2009 Jun; 155(Pt 6):1786-99. doi:10.1099/mic.0.025312-0. PMID:19383680
Hahne H, Wolff S, Hecker M, Becher D From complementarity to comprehensiveness--targeting the membrane proteome of growing Bacillus subtilis by divergent approaches. Proteomics. 2008 Oct; 8(19):4123-36. doi:10.1002/pmic.200800258. PMID:18763711
Mäder U, Homuth G, Scharf C, Büttner K, Bode R, Hecker M Transcriptome and proteome analysis of Bacillus subtilis gene expression modulated by amino acid availability. Journal of bacteriology. 2002 Aug; 184(15):4288-95. . PMID:12107147
Huang X, Gaballa A, Cao M, Helmann JD Identification of target promoters for the Bacillus subtilis extracytoplasmic function sigma factor, sigma W. Molecular microbiology. 1999 Jan; 31(1):361-71. . PMID:9987136