clpC

168

AAA unfoldase, ATPase subunit of the ClpC-ClpP protease, directs proteins phosphorylated on arginine residues to ClpP

Locus: BSU_00860

Molecular weight: 89.93 kDa

Isoelectric point: 5.75

Protein length: 810 aa

Gene length: 2433 bp

Function: protein degradation, positive regulator of autolysin (LytC and LytD) synthesis

Product: AAA unfoldase, ATPase subunit of the ClpC-ClpP protease

Essential: no

Synonyms: clpC, mecB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0542 (Galperin et al., 2021)

Gene

Coordinates: 103,572  106,004

Phenotypes of a mutant

• inactivation of clpC reduces sporulation efficiency to 0.4% that of wild type cells; delayed entry into sporulation, defect in engulfment with reduced SigG activity, and production of small spores PubMed
• defective in Swarming motility PubMed

The protein

Catalyzed reaction/ biological activity

• ATPase/chaperone

Protein family

• ClpA/ClpB family (with ClpE, according to UniProt)

Domains

• AAA-ATPase PFAM
• UVR domain (aa 417-452) (according to UniProt)

Structure

• 7ABR (PDB) PubMed
• 3J3T (PDB) (MecA₆-ClpC₆ complex) PubMed
• 3PXG (PDB) PubMed
• 8B3S (PDB) (the MdfA-ClpC complex) bioRxiv
• P37571 (AlphaFold)

Modification

• phosphorylated on Arg-5 and Arg-254 PubMed
• phosphorylated on Arg-70 PubMed

Paralogous protein(s)

• ClpE

Localization

• cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heatshock, colocalization with ClpP Pubmed
• forms foci coincident with nucleoid edges, usually near cell poles PubMed

Additional information

• subject to Clp-dependent proteolysis upon glucose starvation PubMed

Expression and Regulation

Operons

• Genes: ctsR-mcsA-mcsB-clpC-radA-disA

  Description: PubMed

  Regulation

  • expressed during germination and spore outgrowth PubMed

  Regulatory mechanism

  • CtsR: repression, PubMed, in ctsR regulon
  • Spx: activation, PubMed, in spx regulon

  Sigma factors

  • SigM: sigma factor, PubMed, in sigM regulon
  • SigA: sigma factor, PubMed, in sigA regulon
  • SigB: sigma factor, PubMed PubMed, in sigB regulon
  • SigF: sigma factor, PubMed, in sigF regulon

Biological materials

Mutant

• GP3782 (ΔclpC::neo) available in Jörg Stülke's lab
• GP3808 (ΔclpC::spc) available in Jörg Stülke's lab
• clpC::tet available from the Hamoen Lab
• BP98 (clpC::spc), available in Fabian Commichau's lab PubMed
• BKE00860 (clpC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCGTTCTGTAAATCTTCCAA,  downstream forward: _UP4_TAATATAGAAGACGGAAATG
• BKK00860 (clpC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCGTTCTGTAAATCTTCCAA,  downstream forward: _UP4_TAATATAGAAGACGGAAATG

Expression vectors

• pGP3684 (N-terminal 6xHis-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab
• pGP3924: expression of clpC by pBQ200 in B. subtilis, available in Jörg Stülke's lab

Antibody

• available in Ulf Gerth's and Jörg Stülke's labs

GFP fusion

• C-terminal GFP fusions (single copy, also as CFP and YFP variants) available from the Hamoen Lab

Labs working on this gene/protein

• Leendert Hamoen, Newcastle University, UK homepage
• Kürsad Turgay, Freie Universitt Berlin, Germany homepage

References

Reviews

Loading

Original Publications

Loading