parA

168

ATPase, centromere-like function involved in forespore chromosome partitioning / negative regulation of Sporulation initiation, regulator of SMC complex dynamics

Locus: BSU_40970

Molecular weight: 27.39 kDa

Isoelectric point: 4.9

Protein length: 253 aa

Gene length: 762 bp

Function: forespore chromosome partitioning / negative regulation of Sporulation initiation

Product: negative regulator of Sporulation initiation

Essential: no

Synonyms: parA, soj, spo0JA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1192 (Galperin et al., 2021)

Gene

Coordinates: 4,206,397  4,207,158

Phenotypes of a mutant

• defective in oriC segregation during Sporulation PubMed

The protein

Catalyzed reaction/ biological activity

• regulates DNA replication initiation by either inhibiting or activating the DNA replication initiator protein DnaA PubMed; regulation of Spo0A expression PubMed
• has ATPase activity PubMed

Protein family

• ParA family (with FlhG and MinD, according to UniProt)

Structure

• 5U1G (PDB) PubMed
• 5U1J (PDB) PubMed
• P37522 (AlphaFold)

Effectors of protein activity

• ParB inhibits ParA dimerization and concomitant DNA-binding activity by stimulating ParA ATPase activity PubMed

Interactions

• exists as ATP-bound dimer an ADP-bound monomer PubMed

Localization

• polar/ septal at the cell membrane PubMed
• polar localization depends on the proton motive force PubMed

Expression and Regulation

Operons

• Genes: parA-parB

  Description: PubMed

  Regulation

  • repressed under conditions that trigger sporulation (Spo0A) PubMed

  Regulatory mechanism

  • Spo0A: repression, PubMed, in spo0A regulon

Biological materials

Mutant

• BKE40970 (parA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGATGTCACCTACTTTCA,  downstream forward: _UP4_GATTTAGCAAAGGAAGTGGC
• BKK40970 (parA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGATGTCACCTACTTTCA,  downstream forward: _UP4_GATTTAGCAAAGGAAGTGGC

Labs working on this gene/protein

• Heath Murray, Centre for Bacterial Cell Biology, Newcastle, UK homepage

References

Reviews

Park ZM, Ramamurthi KSTo Sporulate or Not to Sporulate: Developmental Checkpoints Monitoring Bacillus subtilis Sporulation.Annual review of microbiology. 2025 Jun 11; . PMID: 40499191
Pulianmackal LT, Vecchiarelli AGPositioning of cellular components by the ParA/MinD family of ATPases.Current opinion in microbiology. 2024 Jun; 79:102485. PMID: 38723344
Roberts DMA new role for monomeric ParA/Soj in chromosome dynamics in Bacillus subtilis.MicrobiologyOpen. 2023 Feb; 12(1):e1344. PMID: 36825885
Galperin MY, Yutin N, Wolf YI, Vera Alvarez R, Koonin EVConservation and Evolution of the Sporulation Gene Set in Diverse Members of the Firmicutes.Journal of bacteriology. 2022 May 31; :e0007922. PMID: 35638784
Gogou C, Japaridze A, Dekker CMechanisms for Chromosome Segregation in Bacteria.Frontiers in microbiology. 2021; 12:685687. PMID: 34220773
Marczynski GT, Petit K, Patel P Crosstalk Regulation Between Bacterial Chromosome Replication and Chromosome Partitioning. Frontiers in microbiology. 2019; 10:279. doi:10.3389/fmicb.2019.00279. PMID:30863373
Jameson KH, Wilkinson AJ Control of Initiation of DNA Replication in Bacillus subtilis and Escherichia coli. Genes. 2017 Jan 10; 8(1). pii:E22. doi:10.3390/genes8010022. PMID:28075389
Hajduk IV, Rodrigues CD, Harry EJ Connecting the dots of the bacterial cell cycle: Coordinating chromosome replication and segregation with cell division. Seminars in cell & developmental biology. 2016 May; 53:2-9. doi:10.1016/j.semcdb.2015.11.012. pii:S1084-9521(15)30010-0. PMID:26706151
Derouiche A, Shi L, Kalantari A, Mijakovic I Evolution and tinkering: what do a protein kinase, a transcriptional regulator and chromosome segregation/cell division proteins have in common? Current genetics. 2016 Feb; 62(1):67-70. doi:10.1007/s00294-015-0513-y. PMID:26286503
Reyes-Lamothe R, Nicolas E, Sherratt DJ Chromosome replication and segregation in bacteria. Annual review of genetics. 2012; 46:121-43. doi:10.1146/annurev-genet-110711-155421. PMID:22934648
Katayama T, Ozaki S, Keyamura K, Fujimitsu K Regulation of the replication cycle: conserved and diverse regulatory systems for DnaA and oriC. Nature reviews. Microbiology. 2010 Mar; 8(3):163-70. doi:10.1038/nrmicro2314. PMID:20157337

Original Publications

O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Koh A, Strahl H, Murray HRegulation of DNA replication initiation by ParA is independent of parS location in Bacillus subtilis.Microbiology (Reading, England). 2022 Oct; 168(10). PMID: 36301085
Roberts DM, Anchimiuk A, Kloosterman TG, Murray H, Wu LJ, Gruber S, Errington JChromosome remodelling by SMC/Condensin in B. subtilis is regulated by monomeric Soj/ParA during growth and sporulation.Proceedings of the National Academy of Sciences of the United States of America. 2022 Oct 11; 119(41):e2204042119. PMID: 36206370
Jindal L, Emberly E DNA segregation under Par protein control. PloS one. 2019; 14(7):e0218520. doi:10.1371/journal.pone.0218520. PMID:31318889
Zhang H, Schumacher MA Structures of partition protein ParA with nonspecific DNA and ParB effector reveal molecular insights into principles governing Walker-box DNA segregation. Genes & development. 2017 Mar 01; 31(5):481-492. doi:10.1101/gad.296319.117. PMID:28373206
Duan Y, Huey JD, Herman JK The DnaA inhibitor SirA acts in the same pathway as Soj (ParA) to facilitate oriC segregation during Bacillus subtilis sporulation. Molecular microbiology. 2016 Nov; 102(3):530-544. doi:10.1111/mmi.13477. PMID:27489185
Duan Y, Huey JD, Herman JK The DnaA inhibitor SirA acts in the same pathway as Soj (ParA) to facilitate oriC segregation during Bacillus subtilis sporulation. Molecular microbiology. 2016 Nov; 102(3):530-544. doi:10.1111/mmi.13477. PMID:27489185
Kloosterman TG, Lenarcic R, Willis CR, Roberts DM, Hamoen LW, Errington J, Wu LJ Complex polar machinery required for proper chromosome segregation in vegetative and sporulating cells of Bacillus subtilis. Molecular microbiology. 2016 Jul; 101(2):333-50. doi:10.1111/mmi.13393. PMID:27059541
Wang X, Le TB, Lajoie BR, Dekker J, Laub MT, Rudner DZ Condensin promotes the juxtaposition of DNA flanking its loading site in Bacillus subtilis. Genes & development. 2015 Aug 01; 29(15):1661-75. doi:10.1101/gad.265876.115. PMID:26253537
Scholefield G, Errington J, Murray H Soj/ParA stalls DNA replication by inhibiting helix formation of the initiator protein DnaA. The EMBO journal. 2012 Mar 21; 31(6):1542-55. doi:10.1038/emboj.2012.6. PMID:22286949
Okumura H, Yoshimura M, Ueki M, Oshima T, Ogasawara N, Ishikawa S Regulation of chromosomal replication initiation by oriC-proximal DnaA-box clusters in Bacillus subtilis. Nucleic acids research. 2012 Jan; 40(1):220-34. doi:10.1093/nar/gkr716. PMID:21911367
Scholefield G, Whiting R, Errington J, Murray H Spo0J regulates the oligomeric state of Soj to trigger its switch from an activator to an inhibitor of DNA replication initiation. Molecular microbiology. 2011 Feb; 79(4):1089-100. doi:10.1111/j.1365-2958.2010.07507.x. PMID:21235642
Strahl H, Hamoen LW Membrane potential is important for bacterial cell division. Proceedings of the National Academy of Sciences of the United States of America. 2010 Jul 06; 107(27):12281-6. doi:10.1073/pnas.1005485107. PMID:20566861
Gruber S, Errington J Recruitment of condensin to replication origin regions by ParB/SpoOJ promotes chromosome segregation in B. subtilis. Cell. 2009 May 15; 137(4):685-96. doi:10.1016/j.cell.2009.02.035. PMID:19450516
Gruber S, Errington J Recruitment of condensin to replication origin regions by ParB/SpoOJ promotes chromosome segregation in B. subtilis. Cell. 2009 May 15; 137(4):685-96. doi:10.1016/j.cell.2009.02.035. PMID:19450516
Murray H, Errington J Dynamic control of the DNA replication initiation protein DnaA by Soj/ParA. Cell. 2008 Oct 03; 135(1):74-84. doi:10.1016/j.cell.2008.07.044. PMID:18854156
Real G, Autret S, Harry EJ, Errington J, Henriques AO Cell division protein DivIB influences the Spo0J/Soj system of chromosome segregation in Bacillus subtilis. Molecular microbiology. 2005 Jan; 55(2):349-67. . PMID:15659156
Molle V, Fujita M, Jensen ST, Eichenberger P, González-Pastor JE, Liu JS, Losick R The Spo0A regulon of Bacillus subtilis. Molecular microbiology. 2003 Dec; 50(5):1683-701. . PMID:14651647
Ogura Y, Ogasawara N, Harry EJ, Moriya S Increasing the ratio of Soj to Spo0J promotes replication initiation in Bacillus subtilis. Journal of bacteriology. 2003 Nov; 185(21):6316-24. . PMID:14563866
Wu LJ, Errington J RacA and the Soj-Spo0J system combine to effect polar chromosome segregation in sporulating Bacillus subtilis. Molecular microbiology. 2003 Sep; 49(6):1463-75. . PMID:12950914
Autret S, Errington J A role for division-site-selection protein MinD in regulation of internucleoid jumping of Soj (ParA) protein in Bacillus subtilis. Molecular microbiology. 2003 Jan; 47(1):159-69. . PMID:12492861
Autret S, Nair R, Errington J Genetic analysis of the chromosome segregation protein Spo0J of Bacillus subtilis: evidence for separate domains involved in DNA binding and interactions with Soj protein. Molecular microbiology. 2001 Aug; 41(3):743-55. . PMID:11532141
Quisel JD, Grossman AD Control of sporulation gene expression in Bacillus subtilis by the chromosome partitioning proteins Soj (ParA) and Spo0J (ParB). Journal of bacteriology. 2000 Jun; 182(12):3446-51. . PMID:10852876
Marston AL, Errington J Dynamic movement of the ParA-like Soj protein of B. subtilis and its dual role in nucleoid organization and developmental regulation. Molecular cell. 1999 Nov; 4(5):673-82. . PMID:10619015
Cervin MA, Spiegelman GB, Raether B, Ohlsen K, Perego M, Hoch JA A negative regulator linking chromosome segregation to developmental transcription in Bacillus subtilis. Molecular microbiology. 1998 Jul; 29(1):85-95. . PMID:9701805
Sharpe ME, Errington J The Bacillus subtilis soj-spo0J locus is required for a centromere-like function involved in prespore chromosome partitioning. Molecular microbiology. 1996 Aug; 21(3):501-9. . PMID:8866474