ptkA

168

protein tyrosine kinase

Locus: BSU_36250

Molecular weight: 25.64 kDa

Isoelectric point: 9.63

Protein length: 237 aa

Gene length: 714 bp

Function: protein phosphorylation

Product: protein tyrosine kinase

Essential: no

Synonyms: ptkA, ywqD

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0489 (Galperin et al., 2021)

Gene

Coordinates: 3,731,822  3,732,535

Phenotypes of a mutant

• Accumulation of extra chromosome equivalents PubMed
• Defect in biofilm formation, this involves the kinase activity, but the target protein is unknown PubMed

The protein

Catalyzed reaction/ biological activity

• ATP + L-tyrosyl-[protein] --> ADP + H⁺ + O-phospho-L-tyrosyl-[protein] (according to UniProt)
• autophosphorylation, phosphorylation of Ugd, TuaD, SsbB, SsbB

Protein family

• BY-kinase, see the Bacterial Protein Tyrosine Kinase Database
• CpsD/CapB family (with EpsB, according to UniProt)

Domains

• single BY-kinase domain

Cofactors

• ATP

Structure

• 2VED (PDB) (CapB, the homolog in Staphylococcus aureus)
• P96716 (AlphaFold)

Modification

• autophosphorylation at residues Y225, Y227 and Y228 (primary site) PubMed, dephosphorylated by PtpZ PubMed

Effectors of protein activity

• TkmA - transmembrane modulator, activates PtkA autophosphorylation and substrate phosphorylation PubMed
• the mutually exclusive interactions of PtsA with the modulator proteins TkmA, SalA, and probably MinD direct the kinase to different substrates PubMed
• activity is inhibited by DefA during oxidative stress PubMed

Paralogous protein(s)

• EpsB

Expression and Regulation

Operons

• Genes: tkmA-ptkA-ptpZ-ugd

  Description: PubMed

  Regulatory mechanism

  • Spo0A: activation, PubMed, in spo0A regulon
  • DegU: activation, DegU-P, PubMed, in degU regulon
  • AbrB: repression, PubMed, in abrB regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• MGNA-A078 (ywqD::erm), available at the NBRP B. subtilis, Japan
• KO strain created with pMUTIN-2, available from Ivan Mijakovic
• GP1520 (spc), available in Jörg Stülke's lab
• GP1544 (ermC), available in Jörg Stülke's lab
• GP1587 (cat) , available in Jörg Stülke's lab
• GP1521 ''epsB (aphA3) ptkA'' (spc) double mutant available in Jörg Stülke's lab
• GP1529 ''tkmA-ptkA''::spc available in Jörg Stülke's lab
• GP1610 (''ptkA-ptpZ'', spc), available in Jörg Stülke's lab
• BKE36250 (ptkA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CTGCATCCGCGAGCCTCTGT,  downstream forward: _UP4_TAAATAACGTGCATCGTGCC
• BKK36250 (ptkA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CTGCATCCGCGAGCCTCTGT,  downstream forward: _UP4_TAAATAACGTGCATCGTGCC

Expression vectors

• pQE-30, N-terminally 6xHis-tagged, available from Ivan Mijakovic

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

LacZ fusion

• in a KO strain created with pMUTIN-2, available from Ivan Mijakovic

GFP fusion

• CFP-fusion, available from Ivan Mijakovic

Labs working on this gene/protein

• Ivan Mijakovic, Thiverval-Grignon, France

References

Reviews

Loading

Original Publications

Loading