epsA

168

extracellular polysaccharide synthesis, putative transmembrane modulator of EpsB activity, might activate EpsB autophosphorylation and substrate phosphorylation

Locus: BSU_34370

Molecular weight: 25.75 kDa

Isoelectric point: 6.07

Protein length: 234 aa

Gene length: 705 bp

Function: biofilm formation

Product: unknown

Essential: no

Synonyms: epsA, yveK

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Protein synthesis, modification and degradation, Protein modification, Protein kinases

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation, Matrix polysaccharide synthesis

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG3944 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, AbrB regulon, SinR regulon, RemA regulon, EAR riboswitch

Gene

Coordinates: 3,529,151 → 3,529,855

The protein

Protein family

CapA family (with CapA and TkmA, according to UniProt)
CpsC/CapA family (with TkmA, according to UniProt)

Structure

P71050 (AlphaFold)

Paralogous protein(s)

TkmA

Localization

cell membrane (according to UniProt)

Expression and Regulation

Operons

Genes: epsA-epsB-epsC-epsD-epsE-epsF-epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO

Description: PubMed

Regulation

repressed by SinR PubMed

Regulatory mechanism

RemA: activation, PubMed, in remA regulon
AbrB: repression, PubMed, in abrB regulon
SinR: anti-activation, (prevents binding of RemA) PubMed, in sinR regulon
EAR riboswitch: processive antitermination, in EAR riboswitch

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Additional information

induction by sequestration of SinR by SinI or SlrA PubMed

Biological materials

Mutant

MGNA-A073 (yveK::erm), available at the NBRP B. subtilis, Japan
GP1517 (aphA3) PubMed, available in Jörg Stülke's lab
GP1519 (''epsA-epsB'', aphA3) PubMed, available in Jörg Stülke's lab
GP1567 ''epsA::aphA3 tkmA''::spc PubMed, available in Jörg Stülke's lab
BKE34370 (ΔepsA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTATTCATAGCCTTCAG,  downstream forward: _UP4_AAACATTTCGGGGAGTGAAG
BKK34370 (ΔepsA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTATTCATAGCCTTCAG,  downstream forward: _UP4_AAACATTTCGGGGAGTGAAG

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH) PubMed, available in Jörg Stülke's lab

FLAG-tag construct

GP1526 epsA-FLAG 3x spc (based on pGP1331) PubMed, available in Jörg Stülke's lab

Antibody

**

GFP fusion

GP1569 epsA-gfp (spc), available in Jörg Stülke's lab

Labs working on this gene/protein

Richard Losick, Harvard Univ., Cambridge, USA homepage

References

Reviews

Marvasi M, Visscher PT, Casillas Martinez L Exopolymeric substances (EPS) from Bacillus subtilis: polymers and genes encoding their synthesis. FEMS microbiology letters. 2010 Dec; 313(1):1-9. doi:10.1111/j.1574-6968.2010.02085.x. PMID:20735481

Original Publications

O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Martin M, Dragoš A, Otto SB, Schäfer D, Brix S, Maróti G, Kovács ÁTCheaters shape the evolution of phenotypic heterogeneity in Bacillus subtilis biofilms.The ISME journal. 2020 Sep; 14(9):2302-2312. PMID: 32483306
Gao T, Greenwich J, Li Y, Wang Q, Chai Y The Bacterial Tyrosine Kinase Activator TkmA Contributes to Biofilm Formation Largely Independently of the Cognate Kinase PtkA in Bacillus subtilis. Journal of bacteriology. 2015 Nov; 197(21):3421-32. doi:10.1128/JB.00438-15. PMID:26283769
Elsholz AK, Wacker SA, Losick R Self-regulation of exopolysaccharide production in Bacillus subtilis by a tyrosine kinase. Genes & development. 2014 Aug 01; 28(15):1710-20. doi:10.1101/gad.246397.114. PMID:25085422
Gerwig J, Kiley TB, Gunka K, Stanley-Wall N, Stülke J The protein tyrosine kinases EpsB and PtkA differentially affect biofilm formation in Bacillus subtilis. Microbiology (Reading, England). 2014 Apr; 160(Pt 4):682-91. doi:10.1099/mic.0.074971-0. PMID:24493247
Winkelman JT, Bree AC, Bate AR, Eichenberger P, Gourse RL, Kearns DB RemA is a DNA-binding protein that activates biofilm matrix gene expression in Bacillus subtilis. Molecular microbiology. 2013 Jun; 88(5):984-97. doi:10.1111/mmi.12235. PMID:23646920
Diethmaier C, Pietack N, Gunka K, Wrede C, Lehnik-Habrink M, Herzberg C, Hübner S, Stülke J A novel factor controlling bistability in Bacillus subtilis: the YmdB protein affects flagellin expression and biofilm formation. Journal of bacteriology. 2011 Nov; 193(21):5997-6007. doi:10.1128/JB.05360-11. PMID:21856853
Lehnik-Habrink M, Schaffer M, Mäder U, Diethmaier C, Herzberg C, Stülke J RNA processing in Bacillus subtilis: identification of targets of the essential RNase Y. Molecular microbiology. 2011 Sep; 81(6):1459-73. doi:10.1111/j.1365-2958.2011.07777.x. PMID:21815947
Chumsakul O, Takahashi H, Oshima T, Hishimoto T, Kanaya S, Ogasawara N, Ishikawa S Genome-wide binding profiles of the Bacillus subtilis transition state regulator AbrB and its homolog Abh reveals their interactive role in transcriptional regulation. Nucleic acids research. 2011 Jan; 39(2):414-28. doi:10.1093/nar/gkq780. PMID:20817675
Chai Y, Norman T, Kolter R, Losick R An epigenetic switch governing daughter cell separation in Bacillus subtilis. Genes & development. 2010 Apr 15; 24(8):754-65. doi:10.1101/gad.1915010. PMID:20351052
Kobayashi K SlrR/SlrA controls the initiation of biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Sep; 69(6):1399-410. doi:10.1111/j.1365-2958.2008.06369.x. PMID:18647168
Chai Y, Chu F, Kolter R, Losick R Bistability and biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Jan; 67(2):254-63. . PMID:18047568
Chu F, Kearns DB, Branda SS, Kolter R, Losick R Targets of the master regulator of biofilm formation in Bacillus subtilis. Molecular microbiology. 2006 Feb; 59(4):1216-28. . PMID:16430695
Kearns DB, Chu F, Branda SS, Kolter R, Losick R A master regulator for biofilm formation by Bacillus subtilis. Molecular microbiology. 2005 Feb; 55(3):739-49. . PMID:15661000