epsB

168

extracellular polysaccharide synthesis, protein tyrosine kinase, phosphorylation of EpsE

Locus: BSU_34360

Molecular weight: 24.53 kDa

Isoelectric point: 9.92

Protein length: 227 aa

Gene length: 684 bp

Function: biofilm formation

Product: protein tyrosine kinase

Essential: no

Synonyms: epsB, yveL

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0489 (Galperin et al., 2021)

Gene

Coordinates: 3,528,462  3,529,145

The protein

Catalyzed reaction/ biological activity

• phosphorylation of EpsE, to stimulate EpsE activity and biofilm formation PubMed
• ATP + L-tyrosyl-[protein] --> ADP + H⁺ + O-phospho-L-tyrosyl-[protein] (according to UniProt)

Protein family

• BY kinase, see the Bacterial Protein Tyrosine Kinase Database
• CpsD/CapB family (with PtkA, according to UniProt)

Structure

• 2VED (PDB) (CapB, the homolog in Staphylococcus aureus) PubMed
• P71051 (AlphaFold)

Modification

• autophosphorylated on Tyr-225 and Tyr-227 PubMed

Paralogous protein(s)

• PtkA

Expression and Regulation

Operons

• Genes: epsA-epsB-epsC-epsD-epsE-epsF-epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO

  Description: PubMed

  Regulation

  • repressed by SinR PubMed

  Regulatory mechanism

  • RemA: activation, PubMed, in remA regulon
  • AbrB: repression, PubMed, in abrB regulon
  • SinR: anti-activation, (prevents binding of RemA) PubMed, in sinR regulon
  • EAR riboswitch: processive antitermination, in EAR riboswitch

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • induction by sequestration of SinR by SinI or SlrA PubMed

Biological materials

Mutant

• MGNA-A072 (yveL::erm), available at the NBRP B. subtilis, Japan
• GP1518 (aphA3) PubMed, available in Jörg Stülke's lab
• GP1519 (''epsA-epsB'', aphA3) PubMed, available in Jörg Stülke's lab
• BKE34360 (epsB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CTTTTTTCTAAAGATCACTC,  downstream forward: _UP4_TAGTTTTTGTAAAGGTGATG
• BKK34360 (epsB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CTTTTTTCTAAAGATCACTC,  downstream forward: _UP4_TAGTTTTTGTAAAGGTGATG

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH) PubMed, available in Jörg Stülke's lab

FLAG-tag construct

• GP1541 epsB-FLAG 3x spc (based on pGP1331) available in Jörg Stülke's lab

Labs working on this gene/protein

• Richard Losick, Harvard Univ., Cambridge, USA homepage

References

Reviews

Loading

Original Publications

Loading