sacB

sacB
168

levansucrase

Locus
BSU_34450
Molecular weight
52.80 kDa
Isoelectric point
6.18
Protein length
Gene length
Function
utilization of sucrose, production of levan
Product
levansucrase
Essential
no
E.C.
2.4.1.10
Synonyms
sacB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,536,012  3,537,433
Phenotypes of a mutant
defective in tomato root colonization in the presence of sucrose PubMed
The protein
Catalyzed reaction/ biological activity
[6)-β-D-fructofuranosyl-(2→](n) α-D-glucopyranoside + sucrose --> [6)-β-D-fructofuranosyl-(2→](n+1) α-D-glucopyranoside + D-glucose (according to UniProt)
Protein family
glycosyl hydrolase 68 family (single member, according to UniProt)
Structure
1PT2 (PDB) (complex with sucrose),  1OYG (PDB)
secreted (according to Swiss-Prot),  extracellular (signal peptide) PubMed
Expression and Regulation
Operons
Genes
Description
Regulation
the RNA switch RNA is degraded by RNase Y PubMed
Regulatory mechanism
DegU: activation, DegU-P, PubMed, in degU regulon
SacY: antitermination, /antitermination via binding to a RNA switch, in sacY regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

sacBlevB

2025-07-07 17:36:42

Jstuelk

113

045fcc2eb89a1dc92a1a5a36944dc7ec173ff1cf

738CCB0FCDEF80A5E71672A01EA171EF191FFE25

Biological materials
Mutant
BKE34450 (sacB::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT,  downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
BKK34450 (sacB::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT,  downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
LacZ fusion
pGP564 (in pAC7), a series of RAT mutations in pAC7, all available in Jörg Stülke's lab
References
Reviews
Marvasi M, Visscher PT, Casillas Martinez L Exopolymeric substances (EPS) from Bacillus subtilis: polymers and genes encoding their synthesis. FEMS microbiology letters. 2010 Dec; 313(1):1-9. doi:10.1111/j.1574-6968.2010.02085.x. PMID:20735481
Original Publications
Li Z, Bao T, Chen K, Hu C, Zhang X, Hu X, Yang J, Zhang HTailoring of levansucrase product size by a comparative molecular dynamics approach.Enzyme and microbial technology. 2024 Dec 23; 184:110577. PMID: 39721367
Castrejón-Carrillo S, Morales-Moreno LA, Rodríguez-Alegría ME, Zavala-Padilla GT, Bello-Pérez LA, Moreno-Zaragoza J, López Munguía AInsights into the heterogeneity of levan polymers synthesized by levansucrase Bs-SacB from Bacillus subtilis 168.Carbohydrate polymers. 2024 Jan 1; 323:121439. PMID: 37940304
Li Z, Hu C, Chen H, Meng F, Mir B, Hu X, Yang J, Zhang HRational design of a self-assembly promoting fusion domain enhances high molecular weight levan synthesis by levansucrase SacB.International journal of biological macromolecules. 2023 Jun 15; :125442. PMID: 37330087
Tian T, Sun B, Shi H, Gao T, He Y, Li Y, Liu Y, Li X, Zhang L, Li S, Wang Q, Chai YSucrose triggers a novel signaling cascade promoting Bacillus subtilis rhizosphere colonization.The ISME journal. 2021 Mar 26; . PMID: 33772107
Raga-Carbajal E, Díaz-Vilchis A, Rojas-Trejo SP, Rudiño-Piñera E, Olvera CThe molecular basis of the nonprocessive elongation mechanism in levansucrases.The Journal of biological chemistry. 2020 Dec 10; . PMID: 33303628
Ortiz-Soto ME, Porras-Domínguez JR, Rodríguez-Alegría ME, Morales-Moreno LA, Díaz-Vilchis A, Rudiño-Piñera E, Beltrán-Hernandez NE, Rivera HM, Seibel J, López Munguía AImplications of the mutation S164A on Bacillus subtilis levansucrase product specificity and insights into protein interactions acting upon levan synthesis.International journal of biological macromolecules. 2020 Oct 15; 161:898-908. PMID: 32553967
Szwengiel A, Wiesner M Effect of metal ions on levan synthesis efficiency and its parameters by levansucrase from Bacillus subtilis. International journal of biological macromolecules. 2019 Jan 28; . pii:S0141-8130(18)35668-X. doi:10.1016/j.ijbiomac.2019.01.155. PMID:30703417
Raga-Carbajal E, López-Munguía A, Alvarez L, Olvera C Understanding the transfer reaction network behind the non-processive synthesis of low molecular weight levan catalyzed by Bacillus subtilis levansucrase. Scientific reports. 2018 Oct 09; 8(1):15035. doi:10.1038/s41598-018-32872-7. PMID:30301900
DeLoughery A, Lalanne JB, Losick R, Li GW Maturation of polycistronic mRNAs by the endoribonuclease RNase Y and its associated Y-complex in . Proceedings of the National Academy of Sciences of the United States of America. 2018 May 24; . pii:201803283. doi:10.1073/pnas.1803283115. PMID:29794222
Ruiz-Aceituno L, Sanz ML, de Las Rivas B, Muñoz R, Kolida S, Jimeno ML, Moreno FJ Enzymatic synthesis and structural characterization of theanderose through transfructosylation reaction catalyzed by levansucrase from Bacillus subtilis CECT 39. Journal of agricultural and food chemistry. 2017 Nov 13; . doi:10.1021/acs.jafc.7b03092. PMID:29131629
Bersaneti GT, Pan NC, Baldo C, Celligoi MAPC Co-production of Fructooligosaccharides and Levan by Levansucrase from Bacillus subtilis natto with Potential Application in the Food Industry. Applied biochemistry and biotechnology. 2017 Sep 04; . doi:10.1007/s12010-017-2587-0. PMID:28871528
Díez-Municio M, González-Santana C, de Las Rivas B, Jimeno ML, Muñoz R, Moreno FJ, Herrero M Synthesis of potentially-bioactive lactosyl-oligofructosides by a novel bi-enzymatic system using bacterial fructansucrases. Food research international (Ottawa, Ont.). 2015 Dec; 78:258-265. pii:S0963-9969(15)30209-X. doi:10.1016/j.foodres.2015.09.035. PMID:28433290
Raga-Carbajal E, Carrillo-Nava E, Costas M, Porras-Dominguez J, López-Munguía A, Olvera C Size product modulation by enzyme concentration reveals two distinct levan elongation mechanisms in Bacillus subtilis levansucrase. Glycobiology. 2016 Apr; 26(4):377-85. doi:10.1093/glycob/cwv112. PMID:26646447
Méndez-Lorenzo L, Porras-Domínguez JR, Raga-Carbajal E, Olvera C, Rodríguez-Alegría ME, Carrillo-Nava E, Costas M, López Munguía A Intrinsic Levanase Activity of Bacillus subtilis 168 Levansucrase (SacB). PloS one. 2015; 10(11):e0143394. doi:10.1371/journal.pone.0143394. PMID:26600431
Porras-Domínguez JR, Ávila-Fernández Á, Miranda-Molina A, Rodríguez-Alegría ME, Munguía AL Bacillus subtilis 168 levansucrase (SacB) activity affects average levan molecular weight. Carbohydrate polymers. 2015 Nov 05; 132:338-44. doi:10.1016/j.carbpol.2015.06.056. pii:S0144-8617(15)00565-2. PMID:26256357
Olvera C, Centeno-Leija S, Ruiz-Leyva P, López-Munguía A Design of chimeric levansucrases with improved transglycosylation activity. Applied and environmental microbiology. 2012 Mar; 78(6):1820-5. doi:10.1128/AEM.07222-11. PMID:22247149
Voigt B, Antelmann H, Albrecht D, Ehrenreich A, Maurer KH, Evers S, Gottschalk G, van Dijl JM, Schweder T, Hecker M Cell physiology and protein secretion of Bacillus licheniformis compared to Bacillus subtilis. Journal of molecular microbiology and biotechnology. 2009; 16(1-2):53-68. doi:10.1159/000142894. PMID:18957862
Tsukahara K, Ogura M Promoter selectivity of the Bacillus subtilis response regulator DegU, a positive regulator of the fla/che operon and sacB. BMC microbiology. 2008 Jan 15; 8:8. doi:10.1186/1471-2180-8-8. PMID:18197985
Pereira Y, Petit-Glatron MF, Chambert R yveB, Encoding endolevanase LevB, is part of the sacB-yveB-yveA levansucrase tricistronic operon in Bacillus subtilis. Microbiology (Reading, England). 2001 Dec; 147(Pt 12):3413-9. . PMID:11739774
Gay P, Le Coq D, Steinmetz M, Ferrari E, Hoch JA Cloning structural gene sacB, which codes for exoenzyme levansucrase of Bacillus subtilis: expression of the gene in Escherichia coli. Journal of bacteriology. 1983 Mar; 153(3):1424-31. . PMID:6402497
Aymerich S, Steinmetz M Cloning and preliminary characterization of the sacS locus from Bacillus subtilis which controls the regulation of the exoenzyme levansucrase. Molecular & general genetics : MGG. 1987 Jun; 208(1-2):114-20. . PMID:3039303
Shimotsu H, Henner DJ Modulation of Bacillus subtilis levansucrase gene expression by sucrose and regulation of the steady-state mRNA level by sacU and sacQ genes. Journal of bacteriology. 1986 Oct; 168(1):380-8. . PMID:2428811
Crutz AM, Steinmetz M, Aymerich S, Richter R, Le Coq D Induction of levansucrase in Bacillus subtilis: an antitermination mechanism negatively controlled by the phosphotransferase system. Journal of bacteriology. 1990 Feb; 172(2):1043-50. . PMID:2105292

AAA944BE7F01CE90F7730EECA16F3E4ED77D165A

Page visits: 25253

Time of last update: 2025-07-11 11:26:43

Author of last update: Jstuelk