addA

168

ATP-dependent deoxyribonuclease (subunit A), required for efficient survival and replication restart after replication-transcription conflicts, responsible for end resection during dsDNA break repair

Locus: BSU_10630

Molecular weight: 140.85 kDa

Isoelectric point: 5.13

Protein length: 1232 aa

Gene length: 3699 bp

Function: DNA repair/ recombination

Product: ATP-dependent deoxyribonuclease (subunit A))

Essential: no

Synonyms: addA, recE5

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Genetics, DNA repair/ recombination

Information processing, Genetics, DNA repair/ recombination, Other proteins

Information processing, Genetics, Genetic competence

Lifestyles, Exponential and early post-exponential lifestyles, Genetic competence

List of homologs in different organisms, belongs to COG1074 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, ComK regulon

Gene

Coordinates: 1,139,807  1,143,505

Phenotypes of a mutant

reduced survival after mitomycin treatment PubMed
recO addA-addB double mutants are extremely sensitive against DNA damaging agents PubMed
reduced survival after DNA replication arrest imposed by inhibition of PolC activity PubMed

The protein

Catalyzed reaction/ biological activity

the enzyme is functional as a heterodimer of the AddA and AddB subunits, that it is a rapid and processive DNA helicase, and that it catalyses DNA unwinding using one single-stranded DNA motor of 3'5' polarity located in the AddA subunit PubMed
the AddB subunit contains a second putative ATP-binding pocket, but this does not contribute to the observed helicase activity and may instead be involved in the recognition of recombination hotspot sequences PubMed
ATP + H₂O --> ADP + H⁺ + phosphate (according to UniProt)

Protein family

helicase family (according to UniProt)

Domains

UvrD-like helicase ATP-binding domain(aa 9-481) (according to UniProt)
UvrD-like helicase C-terminal domain (aa 508-798) (according to UniProt)

Structure

3U4Q (PDB) (the AddA-AddB-DNA complex) PubMed
P23478 (AlphaFold)

Expression and Regulation

Operons

Genes: addB-addA-sbcD-sbcC-hlpB

Description: PubMed

Regulation

positive control by ComK PubMed

Regulatory mechanism

ComK: activation, in comK regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

GP1106 (addA-addB, spc), available in Jörg Stülke's lab PubMed
BKE10630 (addA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATCTGTCCATGTGCTGTCTG,  downstream forward: _UP4_TAGCGAGATCCATAAGCTCC
BKK10630 (addA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATCTGTCCATGTGCTGTCTG,  downstream forward: _UP4_TAGCGAGATCCATAAGCTCC

Labs working on this gene/protein

Mark Dillingham, Bristol, U.K. (homepage)

References

Reviews

Wang BB, Xu JZ, Zhang F, Liu S, Liu J, Zhang WGReview of DNA repair enzymes in bacteria: With a major focus on AddAB and RecBCD.DNA repair. 2022 Oct; 118:103389. PMID: 36030574
Sinha AK, Possoz C, Leach DRF The roles of bacterial DNA double-strand break repair proteins in chromosomal DNA replication. FEMS microbiology reviews. 2020 Apr 14; . pii:fuaa009. doi:10.1093/femsre/fuaa009. PMID:32286623
Wilkinson M, Wigley DB Structural features of Chi recognition in AddAB with implications for RecBCD. Cell cycle (Georgetown, Tex.). 2014; 13(18):2812-20. doi:10.4161/15384101.2014.950892. PMID:25486468
Wigley DB Bacterial DNA repair: recent insights into the mechanism of RecBCD, AddAB and AdnAB. Nature reviews. Microbiology. 2013 Jan; 11(1):9-13. doi:10.1038/nrmicro2917. PMID:23202527
Lenhart JS, Schroeder JW, Walsh BW, Simmons LA DNA repair and genome maintenance in Bacillus subtilis. Microbiology and molecular biology reviews : MMBR. 2012 Sep; 76(3):530-64. doi:10.1128/MMBR.05020-11. PMID:22933559
Yeeles JT, Dillingham MS The processing of double-stranded DNA breaks for recombinational repair by helicase-nuclease complexes. DNA repair. 2010 Mar 02; 9(3):276-85. doi:10.1016/j.dnarep.2009.12.016. PMID:20116346
Cromie GA Phylogenetic ubiquity and shuffling of the bacterial RecBCD and AddAB recombination complexes. Journal of bacteriology. 2009 Aug; 191(16):5076-84. doi:10.1128/JB.00254-09. PMID:19542287

Original Publications

O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Schons-Fonseca L, Lazova MD, Smith JL, Anderson ME, Grossman ADBeneficial and detrimental genes in the cellular response to replication arrest.PLoS genetics. 2022 Dec 27; 18(12):e1010564. PMID: 36574412
McLean EK, Lenhart JS, Simmons LARecA is required for the assembly of RecN into DNA repair complexes on the nucleoid.Journal of bacteriology. 2021 Aug 2; :JB0024021. PMID: 34339298
Gurung D, Blumenthal RMDistribution of RecBCD and AddAB recombination-associated genes among bacteria in 33 phyla.Microbiology (Reading, England). 2020 Oct 21; . PMID: 33085588
Carrasco B, Yadav T, Serrano E, Alonso JC Bacillus subtilis RecO and SsbA are crucial for RecA-mediated recombinational DNA repair. Nucleic acids research. 2015 Jul 13; 43(12):5984-97. doi:10.1093/nar/gkv545. PMID:26001966
Million-Weaver S, Samadpour AN, Merrikh H Replication Restart after Replication-Transcription Conflicts Requires RecA in Bacillus subtilis. Journal of bacteriology. 2015 Jul; 197(14):2374-82. doi:10.1128/JB.00237-15. PMID:25939832
Gilhooly NS, Dillingham MS Recombination hotspots attenuate the coupled ATPase and translocase activities of an AddAB-type helicase-nuclease. Nucleic acids research. 2014 May; 42(9):5633-43. doi:10.1093/nar/gku188. PMID:24682829
Krajewski WW, Fu X, Wilkinson M, Cronin NB, Dillingham MS, Wigley DB Structural basis for translocation by AddAB helicase-nuclease and its arrest at χ sites. Nature. 2014 Apr 17; 508(7496):416-9. doi:10.1038/nature13037. PMID:24670664
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849
Saikrishnan K, Yeeles JT, Gilhooly NS, Krajewski WW, Dillingham MS, Wigley DB Insights into Chi recognition from the structure of an AddAB-type helicase-nuclease complex. The EMBO journal. 2012 Mar 21; 31(6):1568-78. doi:10.1038/emboj.2012.9. PMID:22307084
Brown CT, Fishwick LK, Chokshi BM, Cuff MA, Jackson JM, Oglesby T, Rioux AT, Rodriguez E, Stupp GS, Trupp AH, Woollcombe-Clarke JS, Wright TN, Zaragoza WJ, Drew JC, Triplett EW, Nicholson WL Whole-genome sequencing and phenotypic analysis of Bacillus subtilis mutants following evolution under conditions of relaxed selection for sporulation. Applied and environmental microbiology. 2011 Oct; 77(19):6867-77. doi:10.1128/AEM.05272-11. PMID:21821766
Fili N, Toseland CP, Dillingham MS, Webb MR, Molloy JE A single-molecule approach to visualize the unwinding activity of DNA helicases. Methods in molecular biology (Clifton, N.J.). 2011; 778:193-214. doi:10.1007/978-1-61779-261-8_13. PMID:21809208
Yeeles JT, Gwynn EJ, Webb MR, Dillingham MS The AddAB helicase-nuclease catalyses rapid and processive DNA unwinding using a single Superfamily 1A motor domain. Nucleic acids research. 2011 Mar; 39(6):2271-85. doi:10.1093/nar/gkq1124. PMID:21071401
Fili N, Mashanov GI, Toseland CP, Batters C, Wallace MI, Yeeles JT, Dillingham MS, Webb MR, Molloy JE Visualizing helicases unwinding DNA at the single molecule level. Nucleic acids research. 2010 Jul; 38(13):4448-57. doi:10.1093/nar/gkq173. PMID:20350930
Yeeles JT, Cammack R, Dillingham MS An iron-sulfur cluster is essential for the binding of broken DNA by AddAB-type helicase-nucleases. The Journal of biological chemistry. 2009 Mar 20; 284(12):7746-55. doi:10.1074/jbc.M808526200. PMID:19129187
Yeeles JT, Dillingham MS A dual-nuclease mechanism for DNA break processing by AddAB-type helicase-nucleases. Journal of molecular biology. 2007 Aug 03; 371(1):66-78. . PMID:17570399
Chédin F, Handa N, Dillingham MS, Kowalczykowski SC The AddAB helicase/nuclease forms a stable complex with its cognate chi sequence during translocation. The Journal of biological chemistry. 2006 Jul 07; 281(27):18610-7. . PMID:16632468
Serganov A, Yuan YR, Pikovskaya O, Polonskaia A, Malinina L, Phan AT, Hobartner C, Micura R, Breaker RR, Patel DJ Structural basis for discriminative regulation of gene expression by adenine- and guanine-sensing mRNAs. Chemistry & biology. 2004 Dec; 11(12):1729-41. . PMID:15610857
Dervyn E, Noirot-Gros MF, Mervelet P, McGovern S, Ehrlich SD, Polard P, Noirot P The bacterial condensin/cohesin-like protein complex acts in DNA repair and regulation of gene expression. Molecular microbiology. 2004 Mar; 51(6):1629-40. . PMID:15009890
Chédin F, Ehrlich SD, Kowalczykowski SC The Bacillus subtilis AddAB helicase/nuclease is regulated by its cognate Chi sequence in vitro. Journal of molecular biology. 2000 Apr 21; 298(1):7-20. . PMID:10756102
Chédin F, Noirot P, Biaudet V, Ehrlich SD A five-nucleotide sequence protects DNA from exonucleolytic degradation by AddAB, the RecBCD analogue of Bacillus subtilis. Molecular microbiology. 1998 Sep; 29(6):1369-77. . PMID:9781875
Haijema BJ, Meima R, Kooistra J, Venema G Effects of lysine-to-glycine mutations in the ATP-binding consensus sequences in the AddA and AddB subunits on the Bacillus subtilis AddAB enzyme activities. Journal of bacteriology. 1996 Sep; 178(17):5130-7. . PMID:8752329
Haijema BJ, Venema G, Kooistra J The C terminus of the AddA subunit of the Bacillus subtilis ATP-dependent DNase is required for the ATP-dependent exonuclease activity but not for the helicase activity. Journal of bacteriology. 1996 Sep; 178(17):5086-91. . PMID:8752323
Alonso JC, Stiege AC, Lüder G Genetic recombination in Bacillus subtilis 168: effect of recN, recF, recH and addAB mutations on DNA repair and recombination. Molecular & general genetics : MGG. 1993 May; 239(1-2):129-36. . PMID:8510642
Kooistra J, Haijema BJ, Venema G The Bacillus subtilis addAB genes are fully functional in Escherichia coli. Molecular microbiology. 1993 Mar; 7(6):915-23. . PMID:8387145
Haijema BJ, Hamoen LW, Kooistra J, Venema G, van Sinderen D Expression of the ATP-dependent deoxyribonuclease of Bacillus subtilis is under competence-mediated control. Molecular microbiology. 1995 Jan; 15(2):203-11. . PMID:7746142