radA

168

branch migration transferase, 6-O-methylguanine-DNA methyltransferase, negative effector of DisA activity, participates in the stabilization and/or processing of holliday junction intermediates, required for repair-by-recombination, crucial for the RecA-dependent acquisition of homologous genes from related species by natural transformation

Locus: BSU_00870

Molecular weight: 49.32 kDa

Isoelectric point: 8.13

Protein length: 458 aa

Gene length: 1377 bp

Function: homologous recombination, control of c-di-AMP formation, co-ordination of responses to replicative stress and genetic recombination

Product: branch migration transferase, 6-O-methylguanine-DNA methyltransferase

Essential: no

Synonyms: radA, sms, yacJ

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Nucleotide metabolism, Metabolism of signalling nucleotides

Information processing, Genetics, DNA repair/ recombination

Information processing, Genetics, DNA repair/ recombination, Other proteins

Lifestyles, Coping with stress, General stress proteins (controlled by SigB)

Lifestyles, Coping with stress, Heat shock proteins

List of homologs in different organisms, belongs to COG1066 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, SigM regulon, CtsR regulon, SigB regulon, SigF regulon, Spx regulon

Gene

Coordinates: 106,096  107,472

Phenotypes of a mutant

reduced spore survival after infrared exposure PubMed
sensitive to mitomycin C and H₂O₂-induced DNA damage PubMed
reduced formation of rpsB or rpsE suppressor mutants after mitomycin treatment PubMed
impaired in transformation with chromosomal DNA PubMed
no transformation with chromosomal DNA in recG mutant cells PubMed

The protein

Catalyzed reaction/ biological activity

reduces the activity of DisA PubMed
binds ssDNA and Holliday junctions (preferentially over dsDNA) PubMed
promotes RecA-mediated DNA strand exchange PubMed
ATPase and 5' --> 3' DNA helicase activity PubMed
unwinds forked DNA in the 5′→3′ direction PubMed

Protein family

RecA family (together with RecA) (according to UniProt)

Domains

N-terminal zinc finger (aa 10 ... 27) (according to UniProt)
central RecA-like ATPase domain (according to UniProt)
KNRFG motif (aa 255 ... 259) (according to UniProt)
C-terminal Lon domain (aa 354 ... 458) (according to UniProt)

Structure

5LKM (PDB) (from Streptococcus pneumoniae, 63% identity) PubMed
P37572 (AlphaFold)

Localization

cytoplasm (according to UniProt)

Expression and Regulation

Operons

Genes: ctsR-mcsA-mcsB-clpC-radA-disA

Description: PubMed

Regulation

expressed during germination and spore outgrowth PubMed

Regulatory mechanism

CtsR: repression, PubMed, in ctsR regulon
Spx: activation, PubMed, in spx regulon

Sigma factors

SigM: sigma factor, PubMed, in sigM regulon
SigA: sigma factor, PubMed, in sigA regulon
SigB: sigma factor, PubMed PubMed, in sigB regulon
SigF: sigma factor, PubMed, in sigF regulon

Biological materials

Mutant

MGNA-B931 (yacJ::erm), available at the NBRP B. subtilis, Japan
BKG1 (''radA::spc''), available in Jörg Stülke's lab
BKG2 (''radA-disA::spc''), available  in Jörg Stülke's lab
BKE00870 (radA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATATAGTGTAAGACCTC,  downstream forward: _UP4_CGTACTTCATTAGGAGGATA
BKK00870 (radA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATATAGTGTAAGACCTC,  downstream forward: _UP4_CGTACTTCATTAGGAGGATA

Expression vectors

pGP2693: expression in E. coli, with C-terminal Strep-tag, in pGP574, available in Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading