sigD

168

RNA polymerase sigma factor SigD

Locus: BSU_16470

Molecular weight: 29.32 kDa

Isoelectric point: 5.17

Protein length: 254 aa

Gene length: 765 bp

Function: regulation of flagella, motility, chemotaxis and autolysis

Product: RNA polymerase sigma factor SigD

Essential: no

Synonyms: sigD, flaB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1191 (Galperin et al., 2021)

Gene

Coordinates: 1,716,493  1,717,257

Phenotypes of a mutant

• Inactivation of ''alsR, sigD and sigW increases competitive fitness of Bacillus subtilis'' under non-sporulating conditions PubMed
• mucoid phenotype due to the overproduction of poly-gamma-glutamate (because of the loss of ''motA-motB'' expression) PubMed
• not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation PubMed
• defective in Swarming motility PubMed

Additional information

• the sigD gene is often inactivated during adaptation to plants PubMed

The protein

Protein family

• Sigma-70 factor family (according to UniProt)

Structure

• 1RP3 (PDB) (SigD-FlgM complex from Aqufex aeolicus, 34% identity) PubMed
• P10726 (AlphaFold)

Effectors of protein activity

• interaction with FlgM inhibits SigD activity PubMed

Expression and Regulation

Operons

• Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • see fla-che operon

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SwrA: activation, in swrA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • SwrA: activation, in swrA regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SinR: transcription elongation, binding of the SinR-SlrR heteromer to sites within fliE and fliI results in inhibition of transcription elongation PubMed, in sinR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

• Genes: sigD-swrB

  Description: PubMed

  Regulation

  • see [[fla-che operon]]

Biological materials

Mutant

• 1A716 ( sigD::cat), PubMed, available at BGSC
• DS6420 (marker-less  in NCIB3610) PubMed
• BKE16470 (sigD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGTTATCCCCCTAATAC,  downstream forward: _UP4_TAATGAATTTCATGGTTAGC
• BKK16470 (sigD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGTTATCCCCCTAATAC,  downstream forward: _UP4_TAATGAATTTCATGGTTAGC

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

FLAG-tag construct

• GP948 (ermC, based on pGP1087), available in the Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading

The SigD regulon

Loading