tatCD

168

component of the TatAD-TatCD twin-arginine translocase

Locus: BSU_02640

Molecular weight: 27.96 kDa

Isoelectric point: 9.34

Protein length: 242 aa

Gene length: 729 bp

Function: TAT protein secretion

Product: component of the twin-arginine translocation pathway

Essential: no

Synonyms: tatCD, ycbT

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Additional metabolic pathways, Phosphate metabolism

Information processing, Protein synthesis, modification and degradation, Protein secretion

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG0805 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, PhoP regulon

Gene

Coordinates: 286,048  286,776

The protein

Catalyzed reaction/ biological activity

translocation of PhoD PubMed

Protein family

tatC family (with TatCY, according to UniProt)

Structure

4B4A (PDB) (from Aquifex aeolicus, 32% identity) PubMed
P42252 (AlphaFold)

Paralogous protein(s)

TatCY

Localization

cell membrane PubMed

Expression and Regulation

Operons

Genes: phoD-tatAD-tatCD

Description: PubMed

Regulation

expressed under conditions of phosphate limitation (PhoP) PubMed

Regulatory mechanism

PhoP: activation, PubMed, in phoP regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Additional information

expression of the operon depends on functional HemAT and CsbC PubMed

Biological materials

Mutant

MGNA-C038 (ycbT::erm), available at the NBRP B. subtilis, Japan
BKE02640 (tatCD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCAAAAAAGCCCTCCCT,  downstream forward: _UP4_AGGGAAGAAACAGCGGCGGC
BKK02640 (tatCD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCAAAAAAGCCCTCCCT,  downstream forward: _UP4_AGGGAAGAAACAGCGGCGGC

Labs working on this gene/protein

Jan Maarten van Dijl, University of Groningen, The Netherlands, Homepage

References

Reviews

Frain KM, Robinson C, van Dijl JM Transport of Folded Proteins by the Tat System. The protein journal. 2019 Aug 10; . doi:10.1007/s10930-019-09859-y. PMID:31401776
Goosens VJ, van Dijl JM Twin-Arginine Protein Translocation. Current topics in microbiology and immunology. 2016 Apr 29; . . PMID:27121927
Cline K Mechanistic Aspects of Folded Protein Transport by the Twin Arginine Translocase (Tat). The Journal of biological chemistry. 2015 Jul 03; 290(27):16530-8. doi:10.1074/jbc.R114.626820. PMID:25975269
Berks BC The twin-arginine protein translocation pathway. Annual review of biochemistry. 2015; 84:843-64. doi:10.1146/annurev-biochem-060614-034251. PMID:25494301
Goosens VJ, Monteferrante CG, van Dijl JM The Tat system of Gram-positive bacteria. Biochimica et biophysica acta. 2014 Aug; 1843(8):1698-706. doi:10.1016/j.bbamcr.2013.10.008. pii:S0167-4889(13)00353-4. PMID:24140208
Palmer T, Berks BC The twin-arginine translocation (Tat) protein export pathway. Nature reviews. Microbiology. 2012 Jun 11; 10(7):483-96. doi:10.1038/nrmicro2814. PMID:22683878

Original Publications

Frain KM, Jones AS, Schoner R, Walker KL, Robinson C The Bacillus subtilis TatAdCd system exhibits an extreme level of substrate selectivity. Biochimica et biophysica acta. 2017 Jan; 1864(1):202-208. pii:S0167-4889(16)30281-6. doi:10.1016/j.bbamcr.2016.10.018. PMID:27984091
Simone D, Bay DC, Leach T, Turner RJ Diversity and evolution of bacterial twin arginine translocase protein, TatC, reveals a protein secretion system that is evolving to fit its environmental niche. PloS one. 2013; 8(11):e78742. doi:10.1371/journal.pone.0078742. PMID:24236045
Rollauer SE, Tarry MJ, Graham JE, Jääskeläinen M, Jäger F, Johnson S, Krehenbrink M, Liu SM, Lukey MJ, Marcoux J, McDowell MA, Rodriguez F, Roversi P, Stansfeld PJ, Robinson CV, Sansom MS, Palmer T, Högbom M, Berks BC, Lea SM Structure of the TatC core of the twin-arginine protein transport system. Nature. 2012 Dec 13; 492(7428):210-4. doi:10.1038/nature11683. PMID:23201679
Monteferrante CG, MacKichan C, Marchadier E, Prejean MV, Carballido-López R, van Dijl JM Mapping the twin-arginine protein translocation network of Bacillus subtilis. Proteomics. 2013 Mar; 13(5):800-11. doi:10.1002/pmic.201200416. PMID:23180473
Monteferrante CG, Baglieri J, Robinson C, van Dijl JM TatAc, the third TatA subunit of Bacillus subtilis, can form active twin-arginine translocases with the TatCd and TatCy subunits. Applied and environmental microbiology. 2012 Jul; 78(14):4999-5001. doi:10.1128/AEM.01108-12. PMID:22544248
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849
Nolandt OV, Walther TH, Roth S, Bürck J, Ulrich AS Structure analysis of the membrane protein TatC(d) from the Tat system of B. subtilis by circular dichroism. Biochimica et biophysica acta. 2009 Oct; 1788(10):2238-44. doi:10.1016/j.bbamem.2009.07.003. PMID:19616508
Ridder AN, de Jong EJ, Jongbloed JD, Kuipers OP Subcellular localization of TatAd of Bacillus subtilis depends on the presence of TatCd or TatCy. Journal of bacteriology. 2009 Jul; 191(13):4410-8. doi:10.1128/JB.00215-09. PMID:19395490
Eijlander RT, Kolbusz MA, Berendsen EM, Kuipers OP Effects of altered TatC proteins on protein secretion efficiency via the twin-arginine translocation pathway of Bacillus subtilis. Microbiology (Reading, England). 2009 Jun; 155(Pt 6):1776-85. doi:10.1099/mic.0.027987-0. PMID:19383693
Jongbloed JD, Grieger U, Antelmann H, Hecker M, Nijland R, Bron S, van Dijl JM Two minimal Tat translocases in Bacillus. Molecular microbiology. 2004 Dec; 54(5):1319-25. . PMID:15554971
Jongbloed JD, Martin U, Antelmann H, Hecker M, Tjalsma H, Venema G, Bron S, van Dijl JM, Müller J TatC is a specificity determinant for protein secretion via the twin-arginine translocation pathway. The Journal of biological chemistry. 2000 Dec 29; 275(52):41350-7. . PMID:11007775
Jongbloed JD, Martin U, Antelmann H, Hecker M, Tjalsma H, Venema G, Bron S, van Dijl JM, Müller J TatC is a specificity determinant for protein secretion via the twin-arginine translocation pathway. The Journal of biological chemistry. 2000 Dec 29; 275(52):41350-7. . PMID:11007775
Eder S, Liu W, Hulett FM Mutational analysis of the phoD promoter in Bacillus subtilis: implications for PhoP binding and promoter activation of Pho regulon promoters. Journal of bacteriology. 1999 Apr; 181(7):2017-25. . PMID:10094677