cdaR

168

effector protein controlling CdaA diadenylate cyclase activity

Locus: BSU_01760

Molecular weight: 52.78 kDa

Isoelectric point: 4.72

Protein length: 483 aa

Gene length: 1452 bp

Function: regulation of c-di-AMP synthesis

Product: effector protein controlling CdaA diadenylate cyclase activity

Essential: no

Synonyms: cdaR, ybbR

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG4856 (Galperin et al., 2021)

Gene

Coordinates: 197,027 → 198,478

The protein

Catalyzed reaction/ biological activity

• stimulates CdaA activity upon protein-protein interaction PubMed

Domains

• YbbR-like 1 domain (aa 55-135) (according to UniProt)
• YbbR-like 2 domain (aa 143-228) (according to UniProt)
• YbbR-like 3 domain (aa 237-316) (according to UniProt)
• YbbR-like 4 domain (aa 329-394) (according to UniProt)

Structure

• 2KPU (PDB) (one YbbR domain, from Desulfitobacterium hafniense) PubMed
• O34659 (AlphaFold)

Localization

• cell membrane, oriented towards the outside PubMed

Expression and Regulation

Operons

• Genes: cdaA-cdaR-glmM-glmS

  Description: PubMed

  Regulatory mechanism

  • GlmS ribozyme: RNA switch, in GlmS ribozyme

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Additional information

• the mRNA is very stable (> 15 min) PubMed

Biological materials

Mutant

• GP999 (ΔcdaR::cat), available in Jörg Stülke's lab PubMed
• GP985 ΔcdaA-cdaR::cat), available in Jörg Stülke's lab PubMed
• BKE01760 (ΔcdaR::erm trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACAGCCCAGCGGTTGTTTA,  downstream forward: _UP4_GAATAAAAAAGGAGCGATTA
• BKK01760 (ΔcdaR::kan trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACAGCCCAGCGGTTGTTTA,  downstream forward: _UP4_GAATAAAAAAGGAGCGATTA

Expression vectors

• IPTG inducible expression of Strep-cdaR in E. coli: pGP2565 (in pGP172), available in Jörg Stülke's lab
• IPTG inducible expression of His-cdaR in E. coli: pGP2557 (in pET19b), available in Jörg Stülke's lab
• GP2031: cdaR-Strep aphA3, chromosomal expression in B. subtilis, for SPINE, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab. Respective plasmids: pGP1989 and pGP1992 PubMed

Antibody

• available in Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading