pgpH

168

c-di-AMP specific phosphodiesterase

Locus: BSU_25330

Molecular weight: 78.98 kDa

Isoelectric point: 7.7

Protein length: 711 aa

Gene length: 2136 bp

Function: control of c-di-AMP homeostasis

Product: c-di-AMP specific phosphodiesterase

Essential: no

Synonyms: pgpH, yqfF

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Nucleotide metabolism, Metabolism of signalling nucleotides

Information processing, Targets of second messengers, Targets of (p)ppGpp

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG1480 (Galperin et al., 2021)

Gene

Coordinates: 2,612,282  2,614,417

Phenotypes of a mutant

a ''gdpP pgpH double mutant acquires suppressor mutations in cdaA'' PubMed
a ''gdpP pgpH'' double mutant is defective in biofilm formation PubMed
altered morphology on MSgg medium PubMed
suppresses the growth defect of glmR mutants on gluconeogenic substrates PubMed
significantly delayed osmoadaptation to high NaCl PubMed

The protein

Catalyzed reaction/ biological activity

hydrolysis of c-di-AMP to 5'-pApA PubMed
3',3'-c-di-AMP + H₂O --> 5'-O-phosphonoadenylyl-(3'→5')-adenosine + H⁺ (according to UniProt)

Protein family

PgpH phosphodiesterase family (single member, according to UniProt)

Domains

HD domain (aa 501-643) (according to UniProt)

Cofactors

Mn²⁺ PubMed

Structure

4S1B (PDB) (the HD domain of the protein from Listeria monocytogenes in complex with c-di-AMP, 58% identity, 85% similarity) PubMed
P46344 (AlphaFold)

Effectors of protein activity

ppGpp acts as allosteric inhibitor of phosphodiesterase activity (in Listeria monocytogenes) PubMed

Localization

cell membrane PubMed

Biological materials

Mutant

MGNA-C432 (yqfF::erm), available at the NBRP B. subtilis, Japan
SM-GN1 (pgpH-spc), available in Anne Galinier's and Boris Görke's labs PubMed
BKE25330 (''pgpH::erm'' without terminator, available in the BGSC and in Jörg Stülke's lab) PubMed
GP2033 (''pgpH::tet'', available in Jörg Stülke's lab)
GP2034 (''pgpH::erm'' without terminator, available in Jörg Stülke's lab) PubMed
GP2040 (''gdpP::spc pgpH::erm'' without terminator, available in Jörg Stülke's lab) PubMed
GP2049 (''pgpH::cat'' without terminator, available in Jörg Stülke's lab)
BKE25330 (pgpH::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACAAGAACCTCCTCTTGAA,  downstream forward: _UP4_GAGGCTACTAAGAAGGTGAA
BKK25330 (pgpH::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACAAGAACCTCCTCTTGAA,  downstream forward: _UP4_GAGGCTACTAAGAAGGTGAA

LacZ fusion

pGP190 (in pAC7), available in Jörg Stülke's lab

Labs working on this gene/protein

Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Loading

Original Publications

Loading