manA

168

mannose-6-phosphate isomerase, required for proper cell wall synthesis

Locus: BSU_12020

Molecular weight: 35.85 kDa

Isoelectric point: 5.28

Protein length: 315 aa

Gene length: 948 bp

Function: mannose utilization

Product: mannose-6-phosphate isomerase

Essential: no

Synonyms: manA, yjdE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1482 (Galperin et al., 2021)

Gene

Coordinates: 1,274,692 → 1,275,639

Phenotypes of a mutant

• cells lose the characteristic rod shape typical of wild type B. subtilis cells and instead appear as elongated spheres, which are significantly larger than normal PubMed

The protein

Catalyzed reaction/ biological activity

• D-mannose 6-phosphate --> D-fructose 6-phosphate (according to UniProt)

Protein family

• mannose-6-phosphate isomerase type 1 family (with GmuF and Pmi, according to UniProt)

Structure

• 1QWR (PDB) (Pmi, 56% identity)
• O31646 (AlphaFold)

Paralogous protein(s)

• GmuF, Pmi

Expression and Regulation

Operons

• Genes: manP-manA-yjdF

  Description: PubMed

  Regulation

  • induced by mannose (ManR) PubMed
  • expession may be controlled by a potential RNA switch located in the 5' untranslated region of the manP-manA-yjdF mRNA between manA and yjdF

  Regulatory mechanism

  • ManR: activation, in the presence of mannose and absence of glucose PubMed, in manR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• MGNA-A265 (yjdE::erm), available at the NBRP B. subtilis, Japan
• BKE12020 (ΔmanA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AGTCGTCATGAAAATCCCCC,  downstream forward: _UP4_TAACATGGCAGGGCTTGAGA
• BKK12020 (ΔmanA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AGTCGTCATGAAAATCCCCC,  downstream forward: _UP4_TAACATGGCAGGGCTTGAGA

References

Reviews

Loading

Original Publications

Loading