codY

168

regulation of a large regulon (more than 100 genes and operons) in response to branched-chain amino acid limitation

Locus: BSU_16170

Molecular weight: 28.86 kDa

Isoelectric point: 4.75

Protein length: 259 aa

Gene length: 780 bp

Function: regulation of a large regulon in response to branched-chain amino acid limitation

Product: transcriptional pleiotropic repressor

Essential: no

Synonyms: codY

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG4465 (Galperin et al., 2021)

Gene

Coordinates: 1,690,119  1,690,898

Phenotypes of a mutant

• no swarming motility on B medium. PubMed
• the mutation suppresses the mucoid phenotype of ''motA or motB'' mutants due to loss of DegU phosphorylation and concomitant reduced expression of the ''capB-capC-capA-capE'' operon PubMed
• inactivation of ''codY suppresses the requirement of a rel sasA sasB'' triple mutant for branched chain amino acids, methionine and threonine PubMed

The protein

Protein family

• codY family (single member, according to UniProt)

Domains

• contains a GAF domain (ligand binding domain)

Structure

• 5LOO (PDB) (unliganded full-length protein) PubMed
• 2B0L (PDB) (C-terminal DNA-binding domain),  2GX5 (PDB) (N-terminal Gaf domain)
• P39779 (AlphaFold)

Modification

• phosphorylation on Ser-215 PubMed

Effectors of protein activity

• GTP and branched chained amino acids (BCAA) increase the affinity of CodY for its DNA target sequences PubMed

Localization

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: trmFO-codV-clpQ-clpY-codY

  Description: PubMed

  Regulation

  • repressed during growth in the presence of branched chain amino acids (CodY) PubMed

  Regulatory mechanism

  • CodY: repression, PubMed, in codY regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • the intracellular concentration of CodY is about 2.5 myM (according to PubMed)

Biological materials

Mutant

• GP566 available in Jörg Stülke's lab
• GP2473 (ΔcodY::spec), available in Jörg Stülke's lab
• GP3453 (ΔcodY::phleo), available in Jörg Stülke's lab
• GP3454 (ΔcodY::cat), available in Jörg Stülke's lab
• a ''codY::erm'' mutant is available in Linc Sonenshein's lab
• a ''codY::spc'' (BB1043) mutant is available in Linc Sonenshein's, Fabian Commichau's and Jörg Stülke's labs
• BKE16170 (codY::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGATAAATAATCCTCCTA,  downstream forward: _UP4_TAATCACAAAAAGAACCCTT
• BKK16170 (codY::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGATAAATAATCCTCCTA,  downstream forward: _UP4_TAATCACAAAAAGAACCCTT

Expression vectors

• pGP244 (for expression, purification in E. coli with Thrombin-cleavable N-terminal His-tag, in pWH844),  available in Jörg Stülke's lab
• pBP616 (N-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP380) (available in Fabian Commichau's lab)
• pBP618 (C-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP382) (available in Fabian Commichau's lab)

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab

Labs working on this gene/protein

• Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
• Tony Wilkinson, York University, U.K. Homepage
• Oscar Kuipers, University of Groningen, The Netherlands, Homepage

References

Reviews

Loading

Original Publications

Loading

The CodY regulon

Loading