glnA

168

glutamine synthetase, trigger enzyme

Locus: BSU_17460

Molecular weight: 50.11 kDa

Isoelectric point: 4.87

Protein length: 444 aa

Gene length: 1335 bp

Function: glutamine biosynthesis, control of TnrA and GlnR activity

Product: glutamine synthetase, trigger enzyme

Essential: no

E.C.: 6.3.1.2

Synonyms: glnA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0174 (Galperin et al., 2021)

Gene

Coordinates: 1,878,425 1,879,759

Phenotypes of a mutant

• auxotrophic for glutamine
• defective in swarming motility (reduced rate of colony expansion) PubMed

The protein

Catalyzed reaction/ biological activity

• ATP + L-glutamate + NH₄⁺ --> ADP + H⁺ + L-glutamine + phosphate (according to UniProt)

Protein family

• glutamine synthetase family (single member, according to UniProt)

Domains

• glutamate binding flap (aa 300 ... 306: protects unstable intermediates from abberant hydrolysis)

Cofactors

• Mg²⁺

Structure

• 4LNN (PDB) (apo-GS) PubMed
• 4S0R (PDB) (the GlnA-TnrA complex) PubMed
• 7TFC (PDB) (the GlnA-GlnR (C tail peptide) complex) PubMed
• P12425 (AlphaFold)

Modification

• phosphorylated on ser/ thr/ tyr PubMed
• in vitro phosphorylated by PrkC on Thr-26, Thr-147, Ser-207, and Thr-286 PubMed

Effectors of protein activity

• feedback inhibition by glutamine, glutamine binds the entrance site for glutamate
• activity is inhibited upon interaction with TnrA PubMed

Kinetic information

• K(M) for: Glu: 27 mM, ATP: 2.4 mM, ammonium: 0.18 mM; v(max): 3.7 mol/min/mg

Localization

• cytoplasm (according to Swiss-Prot)

Additional information

• GlnA is a homooligomer of 12 subunits
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: glnR-glnA

  Description: PubMed

  Regulation

  • expressed in the absence of glutamine (GlnR) PubMed
  • the mRNA is processed between glnR and glnA by RNase Y, this requires the RicA-RicF-RicT complex PubMed

  Regulatory mechanism

  • TnrA: repression, PubMed, in tnrA regulon
  • GlnR: repression, in complex with GlnA, in glnR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

• Genes: ynbA-ynbB-glnR-glnA

  Description: PubMed

  Regulation

  • the mRNA is processed between glnR and glnA by RNase Y, this requires the RicA-RicF-RicT complex PubMed

• Genes: glnA

  Description: PubMed

Biological materials

Mutant

• GP4718 ΔglnA::cat, available in Jörg Stülke's lab
• BKE17460 (glnA::ermC) (available at the BGSC and in Jörg Stülke's lab) PubMed
• GP2263 (glnA::ermC) (available in Jörg Stülke's lab)
• BP148 (del(glnR-glnA)::cat), available in Fabian Commichau's lab
• GP1883 (del(''glnR-glnA)::ermC''), available in Fabian Commichau's and Jörg Stülke's labs
• BKE17460 (glnA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC
• BKK17460 (glnA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC

Expression vectors

• pGP174: expression/ purification from E. coli, with N-terminal Strep-tag (in pGP172): , available in Jörg Stülke's lab
• pGP177: N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pBQ200, available in Jörg Stülke's lab
• pGP2832: N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP380, available in Jörg Stülke's lab

LacZ fusion

• ''glnR-lacZ'': pGP189 (in pAC7), available in Jörg Stülke's lab

Antibody

• available in Karl Forchhammer's lab

Labs working on this gene/protein

• Susan Fisher, Boston, USA homepage

References

Reviews

Loading

Original Publications

Loading