oppD

168

oligopeptide ABC transporter (ATP-binding protein)

Locus: BSU_11460

Molecular weight: 39.61 kDa

Isoelectric point: 6.03

Protein length: 358 aa

Gene length: 1077 bp

Function: initiation of sporulation, competence development

Product: oligopeptide ABC transporter (ATP-binding protein)

Essential: no

Synonyms: oppD, spo0KD

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, ABC transporters, Importers, Uptake of peptides

Metabolism, Amino acid/ nitrogen metabolism, Utilization of nitrogen sources other than amino acids, Utilization of peptides

Information processing, Genetics, Genetic competence

Information processing, Regulation of gene expression, phosphorelay

Lifestyles, Exponential and early post-exponential lifestyles, Genetic competence

Lifestyles, Sporulation, phosphorelay

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG0444 (Galperin et al., 2021)

Gene

Coordinates: 1,223,455  1,224,531

The protein

Catalyzed reaction/ biological activity

required for the uptake of quorum sensing peptides such as PhrH PubMed

Protein family

ABC transporter superfamily (according to UniProt)

Domains

ABC transporter domain (aa 8-259) (according to UniProt)

Structure

4FWI (PDB) (DppD from Caldanaerobacter subterraneus, 39% identity) PubMed
P24136 (AlphaFold)

Paralogous protein(s)

AppD, DppD, YkfD

Localization

attached to the cell membrane (via OppB-OppC) PubMed

Expression and Regulation

Operons

Genes: oppA-oppB-oppC-oppD-oppF

Description: PubMed

Regulation

expressed in the absence of good nitrogen sources (glutamine or ammonium) (TnrA) PubMed

Regulatory mechanism

TnrA: activation, PubMed, in tnrA regulon
CodY: repression, no derepression occurs, however, in a CodY mutant, due to increased repression by ScoC PubMed, in codY regulon
ScoC: repression, PubMed, in scoC regulon

Additional information

A ncRNA is predicted between 'trpS' and 'oppA' PubMed

Biological materials

Mutant

GP2097 (D(''oppA-oppB-oppC-oppD-oppF)::aphA3''), available in Jörg Stülke's lab
BKE11460 (oppD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TAGGCGTGTCACCCGTATCA,  downstream forward: _UP4_GTCTTAGTGAGAGAAGTTGA
BKK11460 (oppD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TAGGCGTGTCACCCGTATCA,  downstream forward: _UP4_GTCTTAGTGAGAGAAGTTGA

References

Loading