nasD

168

assimilatory nitrite reductase (subunit)

Locus: BSU_03300

Molecular weight: 88.24 kDa

Isoelectric point: 4.95

Protein length: 805 aa

Gene length: 2418 bp

Function: utilization of nitrite as nitrogen source

Product: assimilatory nitrite reductase (subunit)

Essential: no

E.C.: 1.7.1.4

Synonyms: nasD, nasBC, nirB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1251 (Galperin et al., 2021)

Gene

Coordinates: 355,764 → 358,181

The protein

Catalyzed reaction/ biological activity

• 2 H₂O + 3 NADP⁺ + NH₄⁺ --> 5 H⁺ + 3 NADPH + nitrite (according to UniProt)
• 2 H₂O + 3 NAD⁺ + NH₄⁺ --> 5 H⁺ + 3 NADH + nitrite (according to UniProt)

Protein family

• nitrite and sulfite reductase 4Fe-4S domain family (with CysI, according to UniProt)

Cofactors

• Fe-S cluster  PubMed
• FAD  PubMed

Structure

• 3KLJ (PDB) (from Clostridium acetobutylicum, corresponds to aa 5 ... 399, 32% identity) PubMed
• P42435 (AlphaFold)

Paralogous protein(s)

• NasB

Expression and Regulation

Operons

• Genes: nasB-nasC-nasD-nasE-nasF

  Description: PubMed

  Regulation

  • ''nasD'': expressed under anaerobic conditions (ResD) PubMed

  Regulatory mechanism

  • ResD: activation, PubMed, in resD regulon
  • TnrA: activation, PubMed, in tnrA regulon
  • NsrR: repression, PubMed, in nsrR regulon
  • Fur: repression, PubMed, in fur regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

• Genes: nasD-nasE-nasF

  Description: PubMed

  Regulation

  • ''nasD'': expressed under anaerobic conditions (ResD) PubMed

Biological materials

Mutant

• 1A973 ( nasD::phleo), PubMed, available at BGSC
• BKE03300 (ΔnasD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCAGATGATCCGCTCCTT,  downstream forward: _UP4_TAATGACAAAAACTATCATT
• BKK03300 (ΔnasD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCAGATGATCCGCTCCTT,  downstream forward: _UP4_TAATGACAAAAACTATCATT

References

Reviews

Luque-Almagro VM, Gates AJ, Moreno-Vivián C, Ferguson SJ, Richardson DJ, Roldán MD Bacterial nitrate assimilation: gene distribution and regulation. Biochemical Society transactions. 2011 Dec; 39(6):1838-43. doi:10.1042/BST20110688. PMID:22103536
Richardson DJ, Berks BC, Russell DA, Spiro S, Taylor CJ Functional, biochemical and genetic diversity of prokaryotic nitrate reductases. Cellular and molecular life sciences : CMLS. 2001 Feb; 58(2):165-78. . PMID:11289299

Original Publications

O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Jacob H, Geng H, Shetty D, Halow N, Kenney LJ, Nakano MMDistinct Interaction Mechanism of RNAP and ResD and Distal Subsites for Transcription Activation of Nitrite Reductase in Bacillus subtilis^ψ.Journal of bacteriology. 2021 Dec 13; :JB0043221. PMID: 34898263
Chumsakul O, Anantsri DP, Quirke T, Oshima T, Nakamura K, Ishikawa S, Nakano MM Genome-wide Identification of ResD, NsrR, and Fur Binding in Bacillus subtilis during Anaerobic Fermentative Growth by in vivo Footprinting. Journal of bacteriology. 2017 Apr 24; . pii:JB.00086-17. doi:10.1128/JB.00086-17. PMID:28439033
Mirouze N, Bidnenko E, Noirot P, Auger S Genome-wide mapping of TnrA-binding sites provides new insights into the TnrA regulon in Bacillus subtilis. MicrobiologyOpen. 2015 Jun; 4(3):423-35. doi:10.1002/mbo3.249. PMID:25755103
Henares B, Kommineni S, Chumsakul O, Ogasawara N, Ishikawa S, Nakano MM The ResD response regulator, through functional interaction with NsrR and fur, plays three distinct roles in Bacillus subtilis transcriptional control. Journal of bacteriology. 2014 Jan; 196(2):493-503. doi:10.1128/JB.01166-13. PMID:24214949
Kommineni S, Yukl E, Hayashi T, Delepine J, Geng H, Moënne-Loccoz P, Nakano MM Nitric oxide-sensitive and -insensitive interaction of Bacillus subtilis NsrR with a ResDE-controlled promoter. Molecular microbiology. 2010 Dec; 78(5):1280-93. doi:10.1111/j.1365-2958.2010.07407.x. PMID:21091510
Nishikawa K, Shomura Y, Kawasaki S, Niimura Y, Higuchi Y Crystal structure of NADH:rubredoxin oxidoreductase from Clostridium acetobutylicum: a key component of the dioxygen scavenging system in obligatory anaerobes. Proteins. 2010 Mar; 78(4):1066-70. doi:10.1002/prot.22650. PMID:20017214
Nakano MM, Geng H, Nakano S, Kobayashi K The nitric oxide-responsive regulator NsrR controls ResDE-dependent gene expression. Journal of bacteriology. 2006 Aug; 188(16):5878-87. . PMID:16885456
Yoshida K, Yamaguchi H, Kinehara M, Ohki YH, Nakaura Y, Fujita Y Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrA box. Molecular microbiology. 2003 Jul; 49(1):157-65. . PMID:12823818
Nakano MM, Zhu Y, Lacelle M, Zhang X, Hulett FM Interaction of ResD with regulatory regions of anaerobically induced genes in Bacillus subtilis. Molecular microbiology. 2000 Sep; 37(5):1198-207. . PMID:10972836
Nakano MM, Hoffmann T, Zhu Y, Jahn D Nitrogen and oxygen regulation of Bacillus subtilis nasDEF encoding NADH-dependent nitrite reductase by TnrA and ResDE. Journal of bacteriology. 1998 Oct; 180(20):5344-50. . PMID:9765565
Wray LV, Ferson AE, Rohrer K, Fisher SH TnrA, a transcription factor required for global nitrogen regulation in Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 1996 Aug 20; 93(17):8841-5. . PMID:8799114
Ogawa K, Akagawa E, Yamane K, Sun ZW, LaCelle M, Zuber P, Nakano MM The nasB operon and nasA gene are required for nitrate/nitrite assimilation in Bacillus subtilis. Journal of bacteriology. 1995 Mar; 177(5):1409-13. . PMID:7868621