gabP

168

gamma-amino butyric acid permease and minor proline permease

Locus: BSU_06310

Molecular weight: 50.93 kDa

Isoelectric point: 9.45

Protein length: 469 aa

Gene length: 1410 bp

Function: utilization of gamma-amino butyric acid

Product: gamma-amino butyric acid permease

Essential: no

Synonyms: gabP, nrg-21

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1113 (Galperin et al., 2021)

Gene

Coordinates: 685,155  686,564

Phenotypes of a mutant

• defective in the utilization of gamma-amino butyrate PubMed

The protein

Catalyzed reaction/ biological activity

• uptake of gamma-amino butyrate PubMed
• minor transporter for proline (allows growth with proline in the absence of the major transporters PutP and OpuE) PubMed

Protein family

• amino acid-polyamine-organocation (APC) superfamily (according to UniProt)

Structure

• P46349 (AlphaFold)

Paralogous protein(s)

• AlaP, HutM, YvbW, AimB, RocC, RocE, YbgF, YdgF, AapA

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: gabP

  Description: PubMed

  Regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) (TnrA) PubMed

  Regulatory mechanism

  • TnrA: activation, PubMed, in tnrA regulon
  • CodY: repression, PubMed, in codY regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• GP3608 (erm), available in Jörg Stülke's lab
• available in Erhard Bremer's lab PubMed
• BKE06310 (gabP::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAGTTACCTCCTTTTAA,  downstream forward: _UP4_TAATGCTGATCAAATCCTAA
• BKK06310 (gabP::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAGTTACCTCCTTTTAA,  downstream forward: _UP4_TAATGCTGATCAAATCCTAA

References

Loading