fliM

168

flagellar C ring protein, motor switch protein

Locus: BSU_16310

Molecular weight: 37.37 kDa

Isoelectric point: 4.69

Protein length: 332 aa

Gene length: 999 bp

Function: movement and chemotaxis

Product: flagellar C ring protein

Essential: no

Synonyms: fliM

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Lifestyles, Exponential and early post-exponential lifestyles, Motility and chemotaxis, Flagellar proteins

Lifestyles, Exponential and early post-exponential lifestyles, Swarming

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG1868 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CodY regulon, SigD regulon, DegU regulon, Spo0A regulon, SinR regulon, SwrA regulon

Gene

Coordinates: 1,701,684  1,702,682

Phenotypes of a mutant

defective in Swarming motility PubMed

The protein

Protein family

FliM family (single member, according to UniProt)

Structure

3SOH (PDB) (central fragment, from Thermotoga maritima, 40% identity) PubMed
P23453 (AlphaFold)

Paralogous protein(s)

FliY

Localization

cell membrane (according to UniProt)
flagellum basal body (according to UniProt)
localizes as individual spots (puncta), this requires FliF PubMed

Expression and Regulation

Operons

Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

Description: PubMed

Regulation

see fla-che operon

Regulatory mechanism

Spo0A: repression, in spo0A regulon
CodY: repression, in codY regulon
DegU: repression, in degU regulon
SwrA: activation, in swrA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon
SigD: sigma factor, PubMed, in sigD regulon

Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

Description: PubMed

Regulation

expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

Regulatory mechanism

Spo0A: repression, in spo0A regulon
SwrA: activation, in swrA regulon
CodY: repression, in codY regulon
DegU: repression, in degU regulon
SinR: transcription elongation, binding of the SinR-SlrR heteromer to sites within fliE and fliI results in inhibition of transcription elongation PubMed, in sinR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon
SigD: sigma factor, PubMed, in sigD regulon

Biological materials

Mutant

BKE16310 (fliM::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTCCTCACCTCCGTAT,  downstream forward: _UP4_GATCACGACATAAGAGGTGA
BKK16310 (fliM::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTCCTCACCTCCGTAT,  downstream forward: _UP4_GATCACGACATAAGAGGTGA

References

Reviews

Loading

Original Publications

Loading