bceB

168

primary bacitracin resistance determinant, ABC transporter (permease), sensory component of the Bce regulatory & detoxification system, protects cell wall biosynthetic targets from inhibition by antimicrobial peptides

Locus: BSU_30370

Molecular weight: 72.01 kDa

Isoelectric point: 9.79

Protein length: 646 aa

Gene length: 1941 bp

Function: protection of cell wall biosynthetic targets from inhibition by antimicrobial peptides

Product: ABC transporter for target protection of cell wall synthesis

Essential: no

Synonyms: bceB, ytsD

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms

Gene

Coordinates: 3,109,397 → 3,111,337

Phenotypes of a mutant

• 85-fold increased sensitivity to bacitracin PubMed

The protein

Catalyzed reaction/ biological activity

• binds bacitracin, K_D: 60 nM PubMed
• inhibits BceS autophosphorylation activity in the absence of bacitracin PubMed
• releaves intermediates of the lipid II cycle from the inhibitory interaction with antimicrobial peptides such as bacitracin PubMed

Protein family

• ABC-4 integral membrane protein family (according to UniProt)

Structure

• 7TCG (PDB) (BceA-BceB) PubMed
• 8G3A (PDB) (BceA-BceB-BceS) PubMed
• O34741 (AlphaFold)

Effectors of protein activity

• the activity of the BceA-BceB ABC transporter is inhibited by heptaprenyl pyrophosphate which accumulates in a ''ytpB'' mutant PubMed

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: bceA-bceB

  Description: PubMed

  Regulation

  • induced in the presence of bacitracin, plectasin, mersacidin and actagardine, already at very low levels of bacitracin (BceR) PubMed

  Regulatory mechanism

  • BceR: activation, PubMed, in bceR regulon

Biological materials

Mutant

• GP3218 Δ(bceR-bceS-bceA-bceB)::cat, available in Jörg Stülke's lab
• MGNA-A168 (ytsD::erm), available at the NBRP B. subtilis, Japan
• BKE30370 (ΔbceB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GATTAATGTTCATGCTGCAC,  downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG
• BKK30370 (ΔbceB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GATTAATGTTCATGCTGCAC,  downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG

Labs working on this gene/protein

• Susanne Gebhard, Bath, UK

References

Reviews

Loading

Original Publications

Loading