spo0A

168

phosphorelay regulator, initiation of sporulation, coordinates DNA replication and initiation of sporulation by binding to sites close to the oriC

Locus: BSU_24220

Molecular weight: 29.54 kDa

Isoelectric point: 5.99

Protein length: 267 aa

Gene length: 804 bp

Function: initiation of sporulation

Product: phosphorelay response regulator

Essential: no

Synonyms: spo0A, spo0C, spo0G, spoIIL, sof-1

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG5801 (Galperin et al., 2021)

Gene

Coordinates: 2,518,023  2,518,826

Phenotypes of a mutant

• inactivation of ''spo0A restores beta-lactam resistance in a sigM'' mutant PubMed
• altered cell death pattern in colonies PubMed

The protein

Catalyzed reaction/ biological activity

• activation of gene expression at the onset of sporulation (Spo0A regulon)
• coordination between DNA replication and initiation of sporulation by binding to sites close to the oriC (this limits re-initiation of replication) PubMed
• required for biofilm formation PubMed
• required for sliding PubMed

Domains

• Response regulatory domain (aa 5-123) (according to UniProt)

Structure

• 1QMP (PDB) (with phosphorylated aspartate, Geobacillus stearothermophilus),  1FC3 (PDB) (trans-activation domain, Geobacillus stearothermophilus),  1LQ1 (PDB) (complex with DNA)
• P06534 (AlphaFold)

Modification

• receives phosphorylation from Spo0B, dephosphorylation by Spo0E, direct phosphorylation by KinC upon potassium leakage PubMed
• phosphorylation is enhanced in a rho mutant PubMed

Effectors of protein activity

• the phosphorylation state affects DNA binding activity
• interaction with MecA inhibits the transcriptional activity of Spo0AP PubMed
• transcription activation by Spo0A-P is inhibited by interaction with MecA (in complex with ClpC) PubMed

Expression and Regulation

Operons

• Genes: spo0A

  Description: PubMed

  Regulation

  • expression increases when drowth rate declines PubMed

  Regulatory mechanism

  • Spo0A: repression, PubMed, in spo0A regulon

  Sigma factors

  • SigA: sigma factor, during vegetative growth PubMed, in sigA regulon
  • SigH: sigma factor, under starvation conditions PubMed, in sigH regulon

Additional information

• efficient translation depends on Efp PubMed

Biological materials

Mutant

• MGNA-C448 (spo0A::erm), available at the NBRP B. subtilis, Japan
• BKG9 (''spo0A::aphA3''), available in Jörg Stülke's lab
• SS995 (''spo0A::ery'') PubMed
• BKE24220 (spo0A::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGTTTCTTCCTCCCCAAA,  downstream forward: _UP4_TAAACATGAGCTTATTAAGT
• BKK24220 (spo0A::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGTTTCTTCCTCCCCAAA,  downstream forward: _UP4_TAAACATGAGCTTATTAAGT
• 3NA (spo0A3), available at BGSC, PubMed, PubMed, Genome Sequence

Labs working on this gene/protein

• Tony Wilkinson, York University, U.K. homepage
• Imrich Barak, Slovak Academy of Science, Bratislava, Slovakia homepage
• Charles Moran, Emory University, NC, USA homepage

References

Reviews

Loading

Original Publications

Loading

The Spo0A regulon

Loading