kinB

168

two-component sensor kinase, phosphorylates Spo0F, part of the phosphorelay

Locus: BSU_31450

Molecular weight: 47.71 kDa

Isoelectric point: 6.68

Protein length: 429 aa

Gene length: 1287 bp

Function: initiation of sporulation

Product: two-component sensor kinase

Essential: no

Synonyms: kinB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG5806 (Galperin et al., 2021)

Gene

Coordinates: 3,230,067 → 3,231,353

The protein

Catalyzed reaction/ biological activity

• autophosphorylation, phosphorylation of Spo0F
• mainly active in the older, inner regions of a colony (with KinA) PubMed
• senses potassium level in the medium during initiation of sliding PubMed
• senses changes in respiratory activity PubMed
• senses nutrient starvation in MM medium to initiate sporulation PubMed
• ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)

Domains

• six transmembrane segments, C-terminal histidine phosphotransferase domain
• selectivity filter sequence of potassium channels that is required for sliding but not for sporulation PubMed
• Histidine kinase domain (aa 218-426) (according to UniProt)

Structure

• 3D36 (PDB) (from G. stearothermophilus, complex with Sda) PubMed
• Q08430 (AlphaFold)

Modification

• autophosphorylation on a His residue

Effectors of protein activity

• activity is triggered at low respiratory activity, this depends on a functional interaction with the respiration apparatus PubMed

Localization

• cell membrane (integral membrane protein) PubMed

Expression and Regulation

Operons

• Genes: kinB-kapB

  Description: PubMed

  Regulation

  • induced upon addition of decoyinine (positive stringent response) PubMed

  Regulatory mechanism

  • CodY: repression, PubMed, in codY regulon
  • stringent response: positive regulation, PubMed, in stringent response
  • SinR: repression, PubMed, in sinR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Additional information

• kinB expression is increased in a rho mutant due to increased transcriptional readthrough PubMed

Biological materials

Mutant

• JH19980 (kinB::tet) PubMed
• BKE31450 (ΔkinB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCGTGTGAAATCCTTTC,  downstream forward: _UP4_TAGCAAATCGATTGGAACTT
• BKK31450 (ΔkinB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCGTGTGAAATCCTTTC,  downstream forward: _UP4_TAGCAAATCGATTGGAACTT

References

Loading