thrR

168

transcription repressor of threonine biosynthetic genes

Locus: BSU_27910

Molecular weight: 16.52 kDa

Isoelectric point: 6.36

Protein length: 147 aa

Gene length: 444 bp

Function: control of threonine biosynthesis

Product: transcription repressor  of threonine biosynthetic genes

Essential: no

Synonyms: thrR, pheB, yszB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Amino acid/ nitrogen metabolism, Biosynthesis/ acquisition of amino acids, Biosynthesis/ acquisition of lysine/ threonine

Information processing, Regulation of gene expression, Transcription factors and their control, Transcription factors/ other

List of homologs in different organisms, belongs to COG4492 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, ThrR regulon

Gene

Coordinates: 2,852,157  2,852,600

Phenotypes of a mutant

resistance to serine PubMed

The protein

Catalyzed reaction/ biological activity

control of the threonine biosynthetic genes (''hom-thrC-thrB and thrD'') PubMed

Protein family

UPF0735 family (single member, according to UniProt)

Domains

putative DNA binding signature (aa 19-51)
ACT domain (aa 70-145) (according to UniProt)

Structure

P21204 (AlphaFold)

Effectors of protein activity

lysine and cysteine (indirectly) inhibit DNA-binding activity of ThrR  PubMed

Expression and Regulation

Operons

Genes: spo0B-obg-thrR-pheA

Description: PubMed

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Additional information

expression is repressed by binding of RpoE to the A-rich sequence in the -35 region of the promoter PubMed

Biological materials

Mutant

BKE27910 (''thrR::erm'', available in the BGSC and in Jörg Stülke's and Fabian Commichau's labs) PubMed
BKE27910 (thrR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTGCATCCCCCCTTTAA,  downstream forward: _UP4_GGTGCATAAGGGAGAGAAAA
BKK27910 (thrR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTGCATCCCCCCTTTAA,  downstream forward: _UP4_GGTGCATAAGGGAGAGAAAA

Expression vectors

pGP2290: expression of thrR in B. subtilis (inpBQ200), available in Jörg Stülke's lab
pBP323 (N-terminal Strep-tag, in pGP172) (available in Fabian Commichau's lab) PubMed
pBP620 (N-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP380) (available in Fabian Commichau's lab) PubMed
pBP622 (C-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP382) (available in Fabian Commichau's lab) PubMed

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab PubMed

LacZ fusion

pGP2291 (in pAC7), available in Jörg Stülke's lab

Labs working on this gene/protein

Fabian Commichau Göttingen, Germany homepage

References

Loading