clpP

168

ATP-dependent Clp protease proteolytic subunit (class III heat-shock protein)

Locus: BSU_34540

Molecular weight: 21.00 kDa

Isoelectric point: 5

Protein length: 197 aa

Gene length: 594 bp

Function: protein degradation

Product: ATP-dependent Clp protease proteolytic subunit

Essential: no

E.C.: 3.4.21.92

Synonyms: clpP, yvdN

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0740 (Galperin et al., 2021)

Gene

Coordinates: 3,546,234 3,546,827

Phenotypes of a mutant

• increased thermotolerance due to increased stabiliy of Spx and thus increased expression of ''trxA'' PubMed
• the mutation suppresses the heat sensitivity of spores overexpressing ''cmpA'' PubMed
• defective în sporulation PubMed
• non-motile PubMed

The protein

Catalyzed reaction/ biological activity

• Hydrolysis of proteins to small peptides in the presence of ATP and magnesium. Alpha-casein is the usual test substrate. In the absence of ATP, only oligopeptides shorter than five residues are hydrolyzed (such as succinyl-Leu-Tyr-|-NHMec, and Leu-Tyr-Leu-|-Tyr-Trp, in which cleavage of the -Tyr-|-Leu- and -Tyr-|-Trp bonds also occurs) (according to UniProt)
• antibiotic-activated ClpP unfolds FtsZ for N-terminal degradation PubMed

Protein family

• Peptidase S14 family (with TepA, according to UniProt)

Structure

• 3KTG (PDB) PubMed
• P80244 (AlphaFold)

Modification

• phosphorylated on Arg-13 PubMed

Effectors of protein activity

• the novel antibiotic ADEP (acyldepsipeptides) dysregulates ClpP activity and allows FtsZ degradation in the absence of an ATPase subunit (ClpC, ClpE, or ClpX) PubMed

Localization

• cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heat shock, colocalization with ClpX, ClpC and ClpE PubMed

Additional information

• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: clpP

  Description: PubMed

  Regulation

  • induced by heat (CtsR) PubMed

  Regulatory mechanism

  • CtsR: repression, PubMed, in ctsR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigB: sigma factor, PubMed, in sigB regulon

Biological materials

Mutant

• clpP::spec and clpP::cat, available in the Leendert Hamoen lab
• BP99 (clpP::tet), available in Fabian Commichau's lab PubMed
• GP551 (spc), available in Jörg Stülke's lab
• QB4916 (spc), available in Ulf Gerths's and Jörg Stülke's labs
• 1S139 (clpP::erm), available at BGSC
• 1S140 ( clpP::spec), available at BGSC
• BKE34540 (''clpP::erm'', available in the BGSC and in Jörg Stülke's lab) PubMed
• GP1822 and GP1786 (''clpP::erm'', available in Jörg Stülke's lab)
• GP3783 (ΔclpP::neo) available in Jörg Stülke's lab
• GPUG1 (erm), available in Ulf Gerth's and Jörg Stülke's labs
• BKE34540 (clpP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGA
• BKK34540 (clpP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGA

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

• available in Ulf Gerth's and Jörg Stülke's labs

GFP fusion

• C-terminal GFP fusions (both single copy and as 2th copy in amyE locus, also as CFP and YFP variants) available in the Leendert Hamoen lab

Labs working on this gene/protein

• Leendert Hamoen, Newcastle University, UK homepage

References

Reviews

Loading

Original Publications

Loading