yugO

168

potassium channel protein (exporter)

Locus: BSU_31322

Molecular weight: 37.00 kDa

Isoelectric point: 7

Protein length: 328 aa

Gene length: 987 bp

Function: potassium exporter

Product: potassium channel protein

Essential: no

Synonyms: yugO

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Homeostasis, Metal ion homeostasis (K, Na, Ca, Mg), Potassium uptake/ export

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation, Regulation

Lifestyles, Sporulation, Sporulation proteins, Newly identified sporulation proteins (based on transcription profiling)

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG0569 (Galperin et al., 2021)

This gene is a member of the following regulons

SinR regulon

Gene

Coordinates: 3,218,854  3,219,840

Phenotypes of a mutant

reduced biofilm formation (can be suppressed by inactivation of ''sinR'') PubMed

The protein

Domains

contains a RCK_N domain (aa 116-245) (according to UniProt)

Structure

3RBZ (PDB) (from Methanothermobacter thermautotrophicus, 24% identity)
Q795M8 (AlphaFold)

Localization

inner spore membrane PubMed

Additional information

potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain PubMed

Expression and Regulation

Operons

Genes: mstX-yugO

Description: PubMed

Regulation

repressed by SinR PubMed

Regulatory mechanism

SinR: repression, PubMed, in sinR regulon

Additional information

potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain PubMed

Biological materials

Mutant

MGNA-A624 (yugO::erm), available at the NBRP B. subtilis, Japan
GP2098 (yugO::ermC), available in Jörg Stülke's lab PubMed
GP2296 (yugO::tet), available in Jörg Stülke's lab
BKE31322 (yugO::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TGAAATAAATATCCGATTTG,  downstream forward: _UP4_GAAACAGATCAATTCCTTGC
BKK31322 (yugO::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TGAAATAAATATCCGATTTG,  downstream forward: _UP4_GAAACAGATCAATTCCTTGC

FLAG-tag construct

GP2442 yugO-3xFLAG spc (based on pGP1331), available in Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading