ktrA

168

high affinity potassium channel KtrA-KtrB, peripheric membrane component

Locus: BSU_31090

Molecular weight: 24.73 kDa

Isoelectric point: 5.98

Protein length: 222 aa

Gene length: 669 bp

Function: potassium uptake

Product: high affinity potassium channel KtrA-KtrB, peripheric membrane component

Essential: no

Synonyms: ktrA, yuaA

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, Transporters/ other, Metal ion transporter

Cellular processes, Homeostasis, Metal ion homeostasis (K, Na, Ca, Mg), Potassium uptake/ export

Information processing, Targets of second messengers, Targets of c-di-AMP

Lifestyles, Coping with stress, Coping with hyper-osmotic stress

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG0569 (Galperin et al., 2021)

This gene is a member of the following regulons

C-di-AMP Riboswitch

Gene

Coordinates: 3,188,414  3,189,082

Phenotypes of a mutant

a kimA ktrA ktrB mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source PubMed
a ktrA-ktrB mutant of B. subtilis NCIB3610 is reduced in sliding (dendritic spreading)
a kimA ktrA-ktrB double mutant is unable to adapt to the presence of 1.2 M NaCl PubMedPubMed

The protein

Catalyzed reaction/ biological activity

high-affinity uptake of K⁺ (in complex with KtrB)

Protein family

KtrA potassium transport family (with KtrC, according to UniProt)

Domains

contains a RCK_N domain at the N-terminus (aa 8-130) (according to UniProt)
contains a RCK_C domain at the C-terminus (aa 139-222) (according to UniProt)

Cofactors

Mg²⁺ (cofactor in the nucleotide-dependent activation of KtrA-KtrB by binding at the intra-dimer KtrA interface site) PubMed
Na⁺, binds at the ATP-KtrA intra-dimer interface, stabilizes the ATP-bound KtrA-KtrB complex and enhances K+ flux activity PubMed

Structure

4J7C (PDB) (the KtrA-KtrB complex) PubMed
8K1T (PDB) (the KtrA-KtrB complex in ATP-bound state with addition of MgCl₂) PubMed
8K1S (PDB) (the KtrA-KtrB complex in ADP-bound state) PubMed
8K1K (PDB) (KtrA with ATP and sodium PubMed
4XTT (PDB) (the S. aureus KtrA RCK_C domain in complex with c-di-AMP, 48% identity) PubMed
1LSU (PDB) (complex with NADH)
2HMW ( complex with ATP)
O32080 (AlphaFold)

Effectors of protein activity

binds ADP and ATP PubMed
activity is inhibited upon binding of c-di-AMP PubMed
Na+ binding at the ATP-KtrA intra-dimer interface stabilizes the ATP-bound KtrA-KtrB complex and enhances K+ flux activity PubMed

Kinetic information

the KtrA-KtrB channel has a high affinity for potassium, this is determined by KtrB PubMed

Paralogous protein(s)

KtrC

Localization

peripheral membrane protein PubMed

Expression and Regulation

Operons

Genes: ktrA-ktrB

Description: PubMed

Regulatory mechanism

c-di-AMP Riboswitch: RNA switch, expression is switched off upon binding of c-di-AMP, in c-di-AMP Riboswitch

Additional information

growth at extreme potassium limitation results in the acquisition of promoter mutations with increased ktrA-ktrB expression PubMed

Biological materials

Mutant

GP4143 (ktrA::lox72 trpC2), available in Jörg Stülke's lab
GP4145 (ktrA::neo trpC2), available in Jörg Stülke's lab
MGNA-B543 (yuaA::erm), available at the NBRP B. subtilis, Japan
1A954 ( ktrA::kan), PubMed, available at BGSC
GHB1 (ktrA-ktrB::aphA3), available in Erhard Bremer's lab
GP92 (ktrA-ktrB::aphA3), available in Jörg Stülke's lab PubMed
GP2083 (ktrA-ktrB::aphA3 ktrC::tet), available in Jörg Stülke's lab PubMed
GP2498 (ktrA-ktrB::spc kimA::cat), available in Jörg Stülke's lab
BKE31090 (ktrA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATGTTCATATCTCCCTTA,  downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
BKK31090 (ktrA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATGTTCATATCTCCCTTA,  downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
GP2716 (ktrA-ktrB::spc), available in Jörg Stülke's lab PubMed
GP3065 (ktrA::kan), available in Jörg Stülke's lab PubMed

Expression vectors

pGP2594: (IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844), available in Jörg Stülke's lab
pGP3713: expression of ktrA (gapA RBS) by pBQ200 in B. subtilis, available in Jörg Stülke's lab

LacZ fusion

GP2176 (based on pAC5), available in Jörg Stülke's lab
GP2177 (based on pAC7), available in Jörg Stülke's lab
GP2299 (based on pAC6), available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

Erhard Bremer, University of Marburg, Germany Homepage
Inga Hänelt, Frankfurt, Germany Homepage
João H Morais-Cabral, University of Porto, Portugal Homepage
Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Stautz J, Hellmich Y, Fuss MF, Silberberg JM, Devlin JR, Stockbridge RB, Hänelt IMolecular mechanisms for bacterial potassium homeostasis.Journal of molecular biology. 2021 Mar 30; :166968. PMID: 33798529
Beagle SD, Lockless SWUnappreciated Roles for K⁺ Channels in Bacterial Physiology.Trends in microbiology. 2021 Oct; 29(10):942-950. PMID: 33288383
Stülke J, Krüger LCyclic di-AMP Signaling in Bacteria.Annual review of microbiology. 2020 Sep 8; 74:159-179. PMID: 32603625
He J, Yin W, Galperin MY, Chou SH Cyclic di-AMP, a second messenger of primary importance: tertiary structures and binding mechanisms. Nucleic acids research. 2020 Apr 06; 48(6):2807-2829. doi:10.1093/nar/gkaa112. PMID:32095817
Schrecker M, Wunnicke D, Hänelt I How RCK domains regulate gating of K+ channels. Biological chemistry. 2019 Jul 27; . doi:10.1515/hsz-2019-0153. pii:/j/bchm.ahead-of-print/hsz-2019-0153/hsz-2019-0153.xml. PMID:31361596
Gundlach J, Commichau FM, Stülke J Perspective of ions and messengers: an intricate link between potassium, glutamate, and cyclic di-AMP. Current genetics. 2017 Aug 20; . doi:10.1007/s00294-017-0734-3. PMID:28825218
Huang KC Staying in Touch while on the Go. Cell. 2017 Jan 12; 168(1-2):15-17. pii:S0092-8674(16)31740-8. doi:10.1016/j.cell.2016.12.024. PMID:28086088
Hoffmann T, Bremer E Guardians in a stressful world: the Opu family of compatible solute transporters from Bacillus subtilis. Biological chemistry. 2017 Feb 01; 398(2):193-214. doi:10.1515/hsz-2016-0265. pii:/j/bchm.2017.398.issue-2/hsz-2016-0265/hsz-2016-0265.xml. PMID:27935846
Commichau FM, Dickmanns A, Gundlach J, Ficner R, Stülke J A jack of all trades: the multiple roles of the unique essential second messenger cyclic di-AMP. Molecular microbiology. 2015 Jul; 97(2):189-204. doi:10.1111/mmi.13026. PMID:25869574
Diskowski M, Mikusevic V, Stock C, Hänelt I Functional diversity of the superfamily of K⁺ transporters to meet various requirements. Biological chemistry. 2015 Sep; 396(9-10):1003-14. doi:10.1515/hsz-2015-0123. pii:/j/bchm.2015.396.issue-9-10/hsz-2015-0123/hsz-2015-0123.xml. PMID:25838295

Original Publications

Chiang WT, Chang YK, Hui WH, Chang SW, Liao CY, Chang YC, Chen CJ, Wang WC, Lai CC, Wang CH, Luo SY, Huang YP, Chou SH, Horng TL, Hou MH, Muench SP, Chen RS, Tsai MD, Hu NJStructural basis and synergism of ATP and Na(+) activation in bacterial K(+) uptake system KtrAB.Nature communications. 2024 May 8; 15(1):3850. PMID: 38719864
Rocha R, Jorge JMP, Teixeira-Duarte CM, Figueiredo-Costa IR, Cereija TB, Ferreira-Teixeira PF, Herzberg C, Stülke J, Morais-Cabral JHc-di-AMP determines the hierarchical organization of bacterial RCK proteins.Proceedings of the National Academy of Sciences of the United States of America. 2024 Apr 30; 121(18):e2318666121. PMID: 38652747
Wendel BM, Pi H, Krüger L, Herzberg C, Stülke J, Helmann JDA Central Role for Magnesium Homeostasis during Adaptation to Osmotic Stress.mBio. 2022 Feb 15; :e0009222. PMID: 35164567
Fernandes AS, Pombinho A, Teixeira-Duarte CM, Morais-Cabral JH, Harley CAFluorometric Liposome Screen for Inhibitors of a Physiologically Important Bacterial Ion Channel.Frontiers in microbiology. 2021; 12:603700. PMID: 33732218
Krüger L, Herzberg C, Warneke R, Poehlein A, Stautz J, Weiß M, Daniel R, Hänelt I, Stülke J Two ways to convert a low- to a high-affinity potassium channel: Control of KtrCD by glutamate. Journal of bacteriology. 2020 Apr 06; . pii:JB.00138-20. doi:10.1128/JB.00138-20. PMID:32253343
Teixeira-Duarte CM, Fonseca F, Morais Cabral JH Activation of a nucleotide-dependent RCK domain requires binding of a cation cofactor to a conserved site. eLife. 2019 Dec 23; 8. doi:10.7554/eLife.50661. pii:e50661. PMID:31868587
Gundlach J, Krüger L, Herzberg C, Turdiev A, Poehlein A, Tascón I, Weiß M, Hertel D, Daniel R, Hänelt I, Lee VT, Stülke J Sustained sensing in potassium homeostasis: Cyclic di-AMP controls potassium uptake by KimA at the levels of expression and activity. The Journal of biological chemistry. 2019 May 06; . pii:jbc.RA119.008774. doi:10.1074/jbc.RA119.008774. PMID:31061098
Rocha R, Teixeira-Duarte CM, Jorge JMP, Morais-Cabral JH Characterization of the molecular properties of KtrC, a second RCK domain that regulates a Ktr channel in Bacillus subtilis. Journal of structural biology. 2019 Feb 09; . pii:S1047-8477(19)30025-5. doi:10.1016/j.jsb.2019.02.002. PMID:30753894
Gundlach J, Herzberg C, Hertel D, Thürmer A, Daniel R, Link H, Stülke J Adaptation of Bacillus subtilis to Life at Extreme Potassium Limitation. mBio. 2017 Jul 05; 8(4). pii:e00861-17. doi:10.1128/mBio.00861-17. PMID:28679749
Diskowski M, Mehdipour AR, Wunnicke D, Mills DJ, Mikusevic V, Bärland N, Hoffmann J, Morgner N, Steinhoff HJ, Hummer G, Vonck J, Hänelt I Helical jackknives control the gates of the double-pore K(+) uptake system KtrAB. eLife. 2017 May 16; 6. doi:10.7554/eLife.24303. pii:e24303. PMID:28504641
Gundlach J, Herzberg C, Kaever V, Gunka K, Hoffmann T, Weiß M, Gibhardt J, Thürmer A, Hertel D, Daniel R, Bremer E, Commichau FM, Stülke J Control of potassium homeostasis is an essential function of the second messenger cyclic di-AMP in Bacillus subtilis. Science signaling. 2017 Apr 18; 10(475). pii:eaal3011. doi:10.1126/scisignal.aal3011. PMID:28420751
Humphries J, Xiong L, Liu J, Prindle A, Yuan F, Arjes HA, Tsimring L, Süel GM Species-Independent Attraction to Biofilms through Electrical Signaling. Cell. 2017 Jan 12; 168(1-2):200-209.e12. pii:S0092-8674(16)31728-7. doi:10.1016/j.cell.2016.12.014. PMID:28086091
Szollosi A, Vieira-Pires RS, Teixeira-Duarte CM, Rocha R, Morais-Cabral JH Dissecting the Molecular Mechanism of Nucleotide-Dependent Activation of the KtrAB K+ Transporter. PLoS biology. 2016 Jan; 14(1):e1002356. doi:10.1371/journal.pbio.1002356. PMID:26771197
Kim H, Youn SJ, Kim SO, Ko J, Lee JO, Choi BS Structural Studies of Potassium Transport Protein KtrA Regulator of Conductance of K+ (RCK) C Domain in Complex with Cyclic Diadenosine Monophosphate (c-di-AMP). The Journal of biological chemistry. 2015 Jun 26; 290(26):16393-402. doi:10.1074/jbc.M115.641340. PMID:25957408
Nelson JW, Sudarsan N, Furukawa K, Weinberg Z, Wang JX, Breaker RR Riboswitches in eubacteria sense the second messenger c-di-AMP. Nature chemical biology. 2013 Dec; 9(12):834-9. doi:10.1038/nchembio.1363. PMID:24141192
Vieira-Pires RS, Szollosi A, Morais-Cabral JH The structure of the KtrAB potassium transporter. Nature. 2013 Apr 18; 496(7445):323-8. doi:10.1038/nature12055. PMID:23598340
Watson PY, Fedor MJ The ydaO motif is an ATP-sensing riboswitch in Bacillus subtilis. Nature chemical biology. 2012 Dec; 8(12):963-5. doi:10.1038/nchembio.1095. PMID:23086297
Block KF, Hammond MC, Breaker RR Evidence for widespread gene control function by the ydaO riboswitch candidate. Journal of bacteriology. 2010 Aug; 192(15):3983-9. doi:10.1128/JB.00450-10. PMID:20511502
Albright RA, Ibar JL, Kim CU, Gruner SM, Morais-Cabral JH The RCK domain of the KtrAB K+ transporter: multiple conformations of an octameric ring. Cell. 2006 Sep 22; 126(6):1147-59. . PMID:16990138
Kinsinger RF, Kearns DB, Hale M, Fall R Genetic requirements for potassium ion-dependent colony spreading in Bacillus subtilis. Journal of bacteriology. 2005 Dec; 187(24):8462-9. . PMID:16321950
Barrick JE, Corbino KA, Winkler WC, Nahvi A, Mandal M, Collins J, Lee M, Roth A, Sudarsan N, Jona I, Wickiser JK, Breaker RR New RNA motifs suggest an expanded scope for riboswitches in bacterial genetic control. Proceedings of the National Academy of Sciences of the United States of America. 2004 Apr 27; 101(17):6421-6. . PMID:15096624
Holtmann G, Bakker EP, Uozumi N, Bremer E KtrAB and KtrCD: two K+ uptake systems in Bacillus subtilis and their role in adaptation to hypertonicity. Journal of bacteriology. 2003 Feb; 185(4):1289-98. . PMID:12562800