ktrA

168

high affinity potassium channel KtrA-KtrB, peripheric membrane component

Locus: BSU_31090

Molecular weight: 24.73 kDa

Isoelectric point: 5.98

Protein length: 222 aa

Gene length: 669 bp

Function: potassium uptake

Product: high affinity potassium channel KtrA-KtrB, peripheric membrane component

Essential: no

Synonyms: ktrA, yuaA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0569 (Galperin et al., 2021)

Gene

Coordinates: 3,188,414  3,189,082

Phenotypes of a mutant

• a kimA ktrA ktrB mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source PubMed
• a ktrA-ktrB mutant of B. subtilis NCIB3610 is reduced in sliding (dendritic spreading)
• a kimA ktrA-ktrB double mutant is unable to adapt to the presence of 1.2 M NaCl PubMedPubMed

The protein

Catalyzed reaction/ biological activity

• high-affinity uptake of K⁺ (in complex with KtrB)

Protein family

• KtrA potassium transport family (with KtrC, according to UniProt)

Domains

• contains a RCK_N domain at the N-terminus (aa 8-130) (according to UniProt)
• contains a RCK_C domain at the C-terminus (aa 139-222) (according to UniProt)

Cofactors

• Mg²⁺ (cofactor in the nucleotide-dependent activation of KtrA-KtrB by binding at the intra-dimer KtrA interface site) PubMed
• Na⁺, binds at the ATP-KtrA intra-dimer interface, stabilizes the ATP-bound KtrA-KtrB complex and enhances K+ flux activity PubMed

Structure

• 4J7C (PDB) (the KtrA-KtrB complex) PubMed
• 8K1T (PDB) (the KtrA-KtrB complex in ATP-bound state with addition of MgCl₂) PubMed
• 8K1S (PDB) (the KtrA-KtrB complex in ADP-bound state) PubMed
• 8K1K (PDB) (KtrA with ATP and sodium PubMed
• 4XTT (PDB) (the S. aureus KtrA RCK_C domain in complex with c-di-AMP, 48% identity) PubMed
• 1LSU (PDB) (complex with NADH)
• 2HMW ( complex with ATP)
• O32080 (AlphaFold)

Effectors of protein activity

• binds ADP and ATP PubMed
• activity is inhibited upon binding of c-di-AMP PubMed
• Na+ binding at the ATP-KtrA intra-dimer interface stabilizes the ATP-bound KtrA-KtrB complex and enhances K+ flux activity PubMed

Kinetic information

• the KtrA-KtrB channel has a high affinity for potassium, this is determined by KtrB PubMed

Paralogous protein(s)

• KtrC

Localization

• peripheral membrane protein PubMed

Expression and Regulation

Operons

• Genes: ktrA-ktrB

  Description: PubMed

  Regulatory mechanism

  • c-di-AMP Riboswitch: RNA switch, expression is switched off upon binding of c-di-AMP, in c-di-AMP Riboswitch

Additional information

• growth at extreme potassium limitation results in the acquisition of promoter mutations with increased ktrA-ktrB expression PubMed

Biological materials

Mutant

• GP4143 (ktrA::lox72 trpC2), available in Jörg Stülke's lab
• GP4145 (ktrA::neo trpC2), available in Jörg Stülke's lab
• MGNA-B543 (yuaA::erm), available at the NBRP B. subtilis, Japan
• 1A954 ( ktrA::kan), PubMed, available at BGSC
• GHB1 (ktrA-ktrB::aphA3), available in Erhard Bremer's lab
• GP92 (ktrA-ktrB::aphA3), available in Jörg Stülke's lab PubMed
• GP2083 (ktrA-ktrB::aphA3 ktrC::tet), available in Jörg Stülke's lab PubMed
• GP2498 (ktrA-ktrB::spc kimA::cat), available in Jörg Stülke's lab
• BKE31090 (ktrA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATGTTCATATCTCCCTTA,  downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
• BKK31090 (ktrA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATGTTCATATCTCCCTTA,  downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
• GP2716 (ktrA-ktrB::spc), available in Jörg Stülke's lab PubMed
• GP3065 (ktrA::kan), available in Jörg Stülke's lab PubMed

Expression vectors

• pGP2594: (IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844), available in Jörg Stülke's lab
• pGP3713: expression of ktrA (gapA RBS) by pBQ200 in B. subtilis, available in Jörg Stülke's lab

LacZ fusion

• GP2176 (based on pAC5), available in Jörg Stülke's lab
• GP2177 (based on pAC7), available in Jörg Stülke's lab
• GP2299 (based on pAC6), available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

• Erhard Bremer, University of Marburg, Germany Homepage
• Inga Hänelt, Frankfurt, Germany Homepage
• João H Morais-Cabral, University of Porto, Portugal Homepage
• Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Loading

Original Publications

Loading