flgE

168

flagellar hook protein

Locus: BSU_16290

Molecular weight: 27.32 kDa

Isoelectric point: 4.73

Protein length: 264 aa

Gene length: 795 bp

Function: movement and chemotaxis

Product: flagellar hook protein

Essential: no

Synonyms: flgE, flgG

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Lifestyles, Exponential and early post-exponential lifestyles, Motility and chemotaxis, Flagellar proteins

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation, Other proteins required for efficient pellicle biofilm formation

Lifestyles, Exponential and early post-exponential lifestyles, Swarming

Groups of genes, Secreted proteins

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG4786 (Galperin et al., 2021)

Gene

Coordinates: 1,700,182 → 1,700,976

Phenotypes of a mutant

not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation PubMed
defective in Swarming motility PubMed

The protein

Catalyzed reaction/ biological activity

part of the flagellar rod-hook (in FliE-FlgB-FlgC-FlhO-FlhP-FlgE out, connection to Hag) PubMed

Protein family

Flagella basal body rod proteins family (according to UniProt)

Structure

3A69 (PDB) (from Salmonella enterica, 44% identity) PubMed
P23446 (AlphaFold)

Paralogous protein(s)

FlhP, FlhO

Localization

bacterial flagellum basal body (according to UniProt)
extracellular (no signal peptide) PubMed
membrane associated PubMed

Expression and Regulation

Operons

Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

Description: PubMed

Regulation

see fla-che operon

Regulatory mechanism

Spo0A: repression, in spo0A regulon
CodY: repression, in codY regulon
DegU: repression, in degU regulon
SwrA: activation, in swrA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon
SigD: sigma factor, PubMed, in sigD regulon

Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

Description: PubMed

Regulation

expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

Regulatory mechanism

Spo0A: repression, in spo0A regulon
SwrA: activation, in swrA regulon
CodY: repression, in codY regulon
DegU: repression, in degU regulon
SinR: transcription elongation, binding of the SinR-SlrR heteromer to sites within fliE and fliI results in inhibition of transcription elongation PubMed, in sinR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon
SigD: sigma factor, PubMed, in sigD regulon

Biological materials

Mutant

DS4681 (marker-less  in NCIB3610) PubMed
BKE16290 (ΔflgE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAATATATTCCCCCAGAT,  downstream forward: _UP4_TAAGGAGGGAGGGGAGGCGA
BKK16290 (ΔflgE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAATATATTCCCCCAGAT,  downstream forward: _UP4_TAAGGAGGGAGGGGAGGCGA

References

Reviews

Loading

Original Publications

Loading