cheV

168

modulation of CheA activity in response to attractants

Locus: BSU_14010

Molecular weight: 34.48 kDa

Isoelectric point: 4.62

Protein length: 303 aa

Gene length: 912 bp

Function: control of CheA activity

Product: CheA modulator

Essential: no

Synonyms: cheV

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0835 (Galperin et al., 2021)

Gene

Coordinates: 1,473,605  1,474,516

Phenotypes of a mutant

• ''cheV cheW'' double mutants exhibit complete loss of chemotaxis PubMed
• not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation PubMed

The protein

Domains

• N-terminal CheW-like domain, C-terminal two-component receiver domain PubMed
• Response regulatory domain (aa 176-302) (according to UniProt)
• CheW-like domain (aa 16-154) (according to UniProt)

Structure

• P37599 (AlphaFold)

Modification

• the C-terminal two-component receiver domain is phosphorylated on a Asp residue by CheA PubMed

Paralogous protein(s)

• CheW, (N-terminal domain of CheV)

Localization

• forms lateral clusters (phosphorylated form), but in the presence of high asparagine concentration (non-phosphorylated form) there is a reversible re-localization to the poles of the cell PubMed

Expression and Regulation

Operons

• Genes: cheV

  Description: PubMed

  Sigma factors

  • SigD: sigma factor, PubMed, in sigD regulon

  Additional information

  • in minimal medium, CheV is present with 7,500 /- 2,000 molecules per cell PubMed

Biological materials

Mutant

• DS70 (cheV::mls in NCIB3610) PubMed
• BKE14010 (cheV::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATTCAATCCCTCGCTATT,  downstream forward: _UP4_TAAATAAAAACAGCCGTTGC
• BKK14010 (cheV::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATTCAATCCCTCGCTATT,  downstream forward: _UP4_TAAATAAAAACAGCCGTTGC

References

Reviews

Rao CV, Glekas GD, Ordal GW The three adaptation systems of Bacillus subtilis chemotaxis. Trends in microbiology. 2008 Oct; 16(10):480-7. doi:10.1016/j.tim.2008.07.003. PMID:18774298

Original Publications

Ortega DR, Zhulin IB Evolutionary Genomics Suggests That CheV Is an Additional Adaptor for Accommodating Specific Chemoreceptors within the Chemotaxis Signaling Complex. PLoS computational biology. 2016 Feb; 12(2):e1004723. doi:10.1371/journal.pcbi.1004723. PMID:26844549
Hölscher T, Bartels B, Lin YC, Gallegos-Monterrosa R, Price-Whelan A, Kolter R, Dietrich LE, Kovács ÁT Motility, Chemotaxis and Aerotaxis Contribute to Competitiveness during Bacterial Pellicle Biofilm Development. Journal of molecular biology. 2015 Nov 20; 427(23):3695-708. doi:10.1016/j.jmb.2015.06.014. pii:S0022-2836(15)00354-X. PMID:26122431
Cannistraro VJ, Glekas GD, Rao CV, Ordal GW Cellular stoichiometry of the chemotaxis proteins in Bacillus subtilis. Journal of bacteriology. 2011 Jul; 193(13):3220-7. doi:10.1128/JB.01255-10. PMID:21515776
Wu K, Walukiewicz HE, Glekas GD, Ordal GW, Rao CV Attractant binding induces distinct structural changes to the polar and lateral signaling clusters in Bacillus subtilis chemotaxis. The Journal of biological chemistry. 2011 Jan 28; 286(4):2587-95. doi:10.1074/jbc.M110.188664. PMID:21098025
Bunn MW, Ordal GW Receptor conformational changes enhance methylesterase activity during chemotaxis by Bacillus subtilis. Molecular microbiology. 2004 Feb; 51(3):721-8. . PMID:14731274
Kearns DB, Losick R Swarming motility in undomesticated Bacillus subtilis. Molecular microbiology. 2003 Aug; 49(3):581-90. . PMID:12864845
Karatan E, Saulmon MM, Bunn MW, Ordal GW Phosphorylation of the response regulator CheV is required for adaptation to attractants during Bacillus subtilis chemotaxis. The Journal of biological chemistry. 2001 Nov 23; 276(47):43618-26. . PMID:11553614
Rosario MM, Fredrick KL, Ordal GW, Helmann JD Chemotaxis in Bacillus subtilis requires either of two functionally redundant CheW homologs. Journal of bacteriology. 1994 May; 176(9):2736-9. . PMID:8169224
Fredrick KL, Helmann JD Dual chemotaxis signaling pathways in Bacillus subtilis: a sigma D-dependent gene encodes a novel protein with both CheW and CheY homologous domains. Journal of bacteriology. 1994 May; 176(9):2727-35. . PMID:8169223