cheV

168

modulation of CheA activity in response to attractants

Locus: BSU_14010

Molecular weight: 34.48 kDa

Isoelectric point: 4.62

Protein length: 303 aa

Gene length: 912 bp

Function: control of CheA activity

Product: CheA modulator

Essential: no

Synonyms: cheV

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Regulation of gene expression, Transcription factors and their control, Control of two-component response regulators, Control of response regulators/ other

Lifestyles, Exponential and early post-exponential lifestyles, Motility and chemotaxis, Signal transduction in motility and chemotaxis, Coupling proteins

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation, Other proteins required for efficient pellicle biofilm formation

Groups of genes, Phosphoproteins, Phosphorylation on an Asp residue

List of homologs in different organisms, belongs to COG0835 (Galperin et al., 2021)

This gene is a member of the following regulons

SigD regulon

Gene

Coordinates: 1,473,605  1,474,516

Phenotypes of a mutant

''cheV cheW'' double mutants exhibit complete loss of chemotaxis PubMed
not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation PubMed

The protein

Domains

N-terminal CheW-like domain, C-terminal two-component receiver domain PubMed
Response regulatory domain (aa 176-302) (according to UniProt)
CheW-like domain (aa 16-154) (according to UniProt)

Structure

P37599 (AlphaFold)

Modification

the C-terminal two-component receiver domain is phosphorylated on a Asp residue by CheA PubMed

Paralogous protein(s)

CheW, (N-terminal domain of CheV)

Localization

forms lateral clusters (phosphorylated form), but in the presence of high asparagine concentration (non-phosphorylated form) there is a reversible re-localization to the poles of the cell PubMed

Expression and Regulation

Operons

Genes: cheV

Description: PubMed

Sigma factors

SigD: sigma factor, PubMed, in sigD regulon

Additional information

in minimal medium, CheV is present with 7,500 /- 2,000 molecules per cell PubMed

Biological materials

Mutant

DS70 (cheV::mls in NCIB3610) PubMed
BKE14010 (cheV::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATTCAATCCCTCGCTATT,  downstream forward: _UP4_TAAATAAAAACAGCCGTTGC
BKK14010 (cheV::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATTCAATCCCTCGCTATT,  downstream forward: _UP4_TAAATAAAAACAGCCGTTGC

References

Reviews

Loading

Original Publications

Loading