spxH

168

adaptor protein for ClpX-ClpP-catalyzed Spx degradation, confers resistance against nitrosating agents

Locus: BSU_11550

Molecular weight: 31.33 kDa

Isoelectric point: 5.21

Protein length: 299 aa

Gene length: 900 bp

Function: stimulation of Spx degradation

Product: adaptor protein

Essential: no

Synonyms: yjbH

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2761 (Galperin et al., 2021)

Gene

Coordinates: 1,233,614  1,234,513

Phenotypes of a mutant

• increased thermotolerance due to increased stabiliy of Spx and thus increased expression of ''trxA'' PubMed
• defective in Swarming motility (periodic cessation and reinitiation of Swarming motility, terracing colonies) PubMed

The protein

Catalyzed reaction/ biological activity

• adaptor protein for ClpX-ClpP-catalyzed Spx degradation PubMed

Protein family

• UPF0413 family (single member, according to UniProt)

Cofactors

• contains Zn atoms (coordinated by the N-terminal His-rich region) PubMed

Structure

• 6GHB (PDB) (oxidized Geobacillus kaustophilus protein complexed with B. subtilis Spx) PubMed
• 6GHO (PDB) (Geobacillus kaustophilus protein complexed with B. subtilis Spx) PubMed
• O31606 (AlphaFold)

Effectors of protein activity

• SpxH aggregates under stress conditions, resulting in the inability to bind to Spx, and therefore in stabilization of Spx PubMed
• Zn atom is released upon treatment with strong oxidants PubMed
• interaction with YirB inhibits the formation of a complex with Spx PubMed

Localization

• cytosolic protein
• aggregates localize at nucleoid-free regions of the cell PubMed

Expression and Regulation

Operons

• Genes: yjbI-spxH

  Description: PubMed

  Regulation

  • induced by cell wall stress (Spx) PubMed

  Regulatory mechanism

  • Spx: activation, PubMed, in spx regulon

  Additional information

  • A ncRNA is predicted between yizD and spxH PubMed

Biological materials

Mutant

• GP2645 (spxH::erm), available in Jörg Stülke's lab
• BKE11550 (''spxH::erm'', available in the BGSC and in Jörg Stülke's lab) PubMed
• BKE11550 (spxH::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GTATAGCTCATGCTGATAGT,  downstream forward: _UP4_TAGCCGCAGGCGTGCATATG
• BKK11550 (spxH::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GTATAGCTCATGCTGATAGT,  downstream forward: _UP4_TAGCCGCAGGCGTGCATATG

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

FLAG-tag construct

• GP3799 (spc, based on pGP1331), available in Jörg Stülke's lab

Labs working on this gene/protein

• Peter Zuber, Oregon Health and Science University, USA
• Homepage
• Claes von Wachenfeldt, Lund University, Sweden Homepage

References

Reviews

Loading

Original Publications

Loading