yidC1

168

Sec-independent membrane protein translocase, essential for SigG activity at stage III, involved in the assembly of the SpoIIIAH-SpoIIQ complex

Locus: BSU_41040

Molecular weight: 29.37 kDa

Isoelectric point: 9.99

Protein length: 261 aa

Gene length: 786 bp

Function: membrane insertion of proteins and protein secretion

Product: membrane protein translocase

Essential: no

Synonyms: yidC1, spoIIIJ, undefined, spo0J87

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0706 (Galperin et al., 2021)

Gene

Coordinates: 4,213,823 → 4,214,608

Phenotypes of a mutant

• defective in sporulation PubMed

Additional information

• a YidC1 gain-of-function mutation (Q140K) is present in B. subtilis strain PY97 PubMed

The protein

Catalyzed reaction/ biological activity

• membrane protein translocase, facilitates insertion of SpoIIIAE into the membrane PubMed

Protein family

• OXA1/ALB3/YidC family (with YidC2, according to UniProt) PubMed

Structure

• 3WO6 (PDB) (from Bacillus halodurans, 51% identity) PubMed
• Q01625 (AlphaFold)

Paralogous protein(s)

• YidC2, one of the two proteins has to be present for viability PubMed

Localization

• membrane PubMed

Expression and Regulation

Operons

• Genes: rpmH-rnpA-yidC1-jag

  Description: PubMed

  Regulation

  • expression is reduced in motile cells as compared to non-motile cells PubMed

• Genes: yidC1-jag

  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • An antisense RNA is predicted for 'jag' PubMed

Biological materials

Mutant

• BKE41040 (ΔyidC1::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCTCCTATAATTAAT,  downstream forward: _UP4_AAGTGAGGAATGTGACTGCT
• BKK41040 (ΔyidC1::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCTCCTATAATTAAT,  downstream forward: _UP4_AAGTGAGGAATGTGACTGCT

Labs working on this gene/protein

• Richard Losick, Harvard University, Cambridge, USA homepage
• Adriano Henriques, Lisbon, Portugal homepage

References

Reviews

Loading

Original Publications

Loading