sda

168

developmental checkpoint protein, controls the phosphorylation status of Spo0A

Locus: BSU_25690

Molecular weight: 6.02 kDa

Isoelectric point: 5.61

Protein length: 52 aa

Gene length: 159 bp

Function: mediates a developmental checkpoint coupling initiation of Sporulation (phosphorylation of Spo0A)to the function of replication initiation proteins

Product: developmental checkpoint protein

Essential: no

Synonyms: sda

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG5851 (Galperin et al., 2021)

Gene

Coordinates: 2,647,456 → 2,647,614

Phenotypes of a mutant

• sporulates at a higher frequency
• will sporulate in the presence of replication stress

The protein

Catalyzed reaction/ biological activity

• Sda is a checkpoint protein that is upregulated in response to replication stress PubMed
• Sda inhibits the autokinase activity of KinA (and likely KinB as well). This in its turn results in reduced levels of Spo0A~P]]. Thus, replication stressed cells will not initiate sporulation.

Structure

• 3D36 (PDB) (from Geobacillus stearothermophilus, complex with KinB) PubMed,  1PV0 (PDB)
• Q7WY62 (AlphaFold)

Expression and Regulation

Operons

• Genes: sda

  Description: PubMed

  Regulation

  • induced by DNA damage (LexA) PubMed

  Regulatory mechanism

  • DnaA: activation, under replication stress PubMed, in dnaA regulon
  • LexA: repression, PubMed, in lexA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • An antisense RNA is predicted for 'sda' PubMed

Additional information

• translation of Sda is reduced during serine starvation due to serine codon hierarchy-mediated regulation PubMed

Biological materials

Mutant

• 1A1034 (no resistance), PubMed, available at BGSC
• BKE25690 (Δsda::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AATGGGAGAGGCACCTCCTT,  downstream forward: _UP4_TAATAGGAATTTGTCTATTT
• BKK25690 (Δsda::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AATGGGAGAGGCACCTCCTT,  downstream forward: _UP4_TAATAGGAATTTGTCTATTT

Labs working on this gene/protein

• Bill Burkholder Homepage

References

Reviews

Loading

Original Publications

Loading