rocG

168

trigger enzyme, glutamate dehydrogenase and effector protein for GltC

Locus: BSU_37790

Molecular weight: 46.48 kDa

Isoelectric point: 6.28

Protein length: 424 aa

Gene length: 1275 bp

Function: arginine utilization, controls the activity of GltC

Product: glutamate dehydrogenase

Essential: no

E.C.: 1.4.1.2

Synonyms: rocG

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0334 (Galperin et al., 2021)

Gene

Coordinates: 3,880,740  3,882,014

Phenotypes of a mutant

• Poor growth on complex media such as SP (sporulation medium). No growth in minimal media with arginine as the only carbon source. Rapid accumulation of suppressor mutants (gudB1]])
• sensitive to beta-lactam antibiotics such as cefuroxime and to fosfomycin (suppressed by activation of ''gudB'') due to the downregulation of the SigW regulon PubMed
• transcription profile of a ''rocG gudB'' mutant strain: GEO PubMed

The protein

Catalyzed reaction/ biological activity

• H₂O + L-glutamate + NAD⁺ --> 2-oxoglutarate + H⁺ + NADH + NH₄⁺ (according to UniProt)
• controls the activity of the GltC transcription activator PubMed

Protein family

• Glu/Leu/Phe/Val dehydrogenases family (with Bcd and GudB, according to UniProt)

Cofactors

• NAD⁺/NADH + H⁺

Structure

• 3K92 (PDB) (super-repressor mutant that is capable of constitutive inactivation of GltC, E93K mutation) PubMed
• P39633 (AlphaFold)

Kinetic information

• K_M [glutamate] = 2.9 mM, K_M [ammonium] = 18 mM PubMed

Paralogous protein(s)

• GudB

Expression and Regulation

Operons

• Genes: rocG

  Description: PubMed

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed
  • induced in the presence of arginine (AhrC) PubMed
  • induced in the presence of arginine, citrulline or ornithine (with ornithine as the molecular inducer) (RocR) PubMed

  Regulatory mechanism

  • RocR: activation, PubMed, in rocR regulon
  • AhrC: activation, PubMed, in ahrC regulon
  • CcpA: repression, PubMed, in ccpA regulon
  • AbrB: repression, PubMed, in abrB regulon

  Sigma factors

  • SigL: sigma factor, PubMed, in sigL regulon

  Additional information

  • Activation by RocR requires binding of RocR to a downstream element PubMed

Biological materials

Mutant

• GP747 (spc), GP810 (del tet), GP1157 (cat) all available in Jörg Stülke's lab
• GP726 (aphA3) available in Jörg Stülke's lab PubMed
• GP1161 (ΔgudB::aphA3 ΔrocG::Tn10 spc), available in Jörg Stülke's lab PubMed
• BKE37790 (rocG::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTTTTTCACCTCATTGT,  downstream forward: _UP4_TAATTTGAGAAGCCTCCGCA
• BKK37790 (rocG::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTTTTTCACCTCATTGT,  downstream forward: _UP4_TAATTTGAGAAGCCTCCGCA

Expression vectors

• expression of native rocG in B. subtilis: pGP529 (in pBQ200), available in Jörg Stülke's lab PubMed
• for purification of RocG from E. coli carrying an N-terminal Strep-tag: pGP902 (in pGP172), a series of rocG variants is also available in pGP172, available in Jörg Stülke's lab
• for expression/ purification from E. coli with N-terminal His-tag and thrombin cleavage site, in pWH844: pGP860, available in Jörg Stülke's lab
• purification from B. subtilis with an N-terminal Strep-tag, for SPINE, (in pGP380): pGP1709, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

• available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

• Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
• Jörg Stülke, University of Göttingen, Germany Homepage
• Fabian Commichau Brandenburg Technical University Cottbus-Senftenberg, Germany Homepage

References

Reviews

Loading

Additional publications

Loading

Enzymatic activity of RocG

Loading

Bypass of rocG mutations

Loading

Structural analysis of glutamate dehydrogenase

Loading

Expression of rocG

Loading

Function in the control of GltC activity

Loading