bshA

168

L-malic acid glycosyltransferase, involved in bacillithiol synthesis

Locus: BSU_22460

Molecular weight: 41.82 kDa

Isoelectric point: 6.15

Protein length: 377 aa

Gene length: 1134 bp

Function: biosynthesis of bacillithiol

Product: L-malic acid glycosyltransferase

Essential: no

Synonyms: bshA, jojH, ypjH

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Additional metabolic pathways, Miscellaneous metabolic pathways, Biosynthesis of bacillithiol

Lifestyles, Coping with stress, Resistance against oxidative and electrophile stress

List of homologs in different organisms, belongs to COG0438 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, Spx regulon

Gene

Coordinates: 2,357,078  2,358,211

Phenotypes of a mutant

impaired growth in minimal medium, reduced activity of enzymes containing FeS cluster PubMed
sensitivity to superoxide (paraquate) stress PubMed

The protein

Catalyzed reaction/ biological activity

UDP-GlcNAc + L-malate --> (S)-malyl N-acetyl-α-D-glucosaminide + H⁺ + UDP PubMed; also uses D-malate as a substrate, but with much lower affinity PubMed

Protein family

Glycosyltransferase 1 family (according to UniProt)
Glycosyltransferase 4 subfamily (according to UniProt)

Structure

5D00 (PDB) PubMed
P42982 (AlphaFold)

Effectors of protein activity

subject to feedback inhibition by bacillithiol PubMed

Expression and Regulation

Operons

Genes: ypjD-dapB-mgsA-bshB1-bshA-cca-birA

Description: PubMed

Regulation

induced by diamide stess (thiol depletion) (Spx) PubMed

Regulatory mechanism

Spx: activation, PubMed, in spx regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

MGNA-A410 (ypjH::erm), available at the NBRP B. subtilis, Japan
bshA::mls available in John_Helmann lab
GP88 (bshA::pX2(cat)), available in Jörg Stülke's lab
BKE22460 (bshA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCTCATTGTTCGCCCCCAAG,  downstream forward: _UP4_GATTTAGCAGAACCGGAGTG
BKK22460 (bshA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCTCATTGTTCGCCCCCAAG,  downstream forward: _UP4_GATTTAGCAGAACCGGAGTG

References

Reviews

Loading

Original Publications

Loading