lysC

168

aspartokinase II (alpha and beta subunits)

Locus: BSU_28470

Molecular weight: 43.65 kDa

Isoelectric point: 4.64

Protein length: 408 aa

Gene length: 1227 bp

Function: biosynthesis of lysine

Product: aspartokinase II (alpha and beta subunits)

Essential: no

E.C.: 2.7.2.4

Synonyms: lysC, ask, aecA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0527 (Galperin et al., 2021)

Gene

Coordinates: 2,909,520 2,910,746

The protein

Catalyzed reaction/ biological activity

• ATP + L-aspartate --> 4-phospho-L-aspartate + ADP (according to UniProt)

Protein family

• aspartokinase family (with DapG and ThrD, according to UniProt)

Domains

• two C-terminal ACT domains (aa 264-337, and aa 343-408) (according to UniProt)

Structure

• 2RE1 (PDB) (from Neisseria meningitidis mc58, 40% identity, 58% similarity)
• P08495 (AlphaFold)

Effectors of protein activity

• feedback inhibition by lysine PubMed

Paralogous protein(s)

• DapG

Localization

• cytoplasm (according to UniProt)

Additional information

• subject to Clp-dependent proteolysis upon glucose starvation PubMed, also degraded upon ammonium or amino acid starvation PubMed
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: lysC

  Description: PubMed

  Regulation

  • expression activated by glucose (5.4 fold) PubMed

  Regulatory mechanism

  • L-box: RNA switch, via a riboswitch, in L-box

Biological materials

Mutant

• BKE28470 (lysC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTATTACCACCCTTTAC, downstream forward: _UP4_TAATGACAATCAAAAAGGCG
• BKK28470 (lysC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTATTACCACCCTTTAC, downstream forward: _UP4_TAATGACAATCAAAAAGGCG

References

Reviews

Dumas R, Cobessi D, Robin AY, Ferrer JL, Curien G The many faces of aspartate kinases. Archives of biochemistry and biophysics. 2012 Mar 15; 519(2):186-93. doi:10.1016/j.abb.2011.10.016. PMID:22079167
Lo CC, Bonner CA, Xie G, D'Souza M, Jensen RA Cohesion group approach for evolutionary analysis of aspartokinase, an enzyme that feeds a branched network of many biochemical pathways. Microbiology and molecular biology reviews : MMBR. 2009 Dec; 73(4):594-651. doi:10.1128/MMBR.00024-09. PMID:19946135

Research papers

Kato C, Kurihara T, Kobashi N, Yamane H, Nishiyama M Conversion of feedback regulation in aspartate kinase by domain exchange. Biochemical and biophysical research communications. 2004 Apr 09; 316(3):802-8. . PMID:15033471

The L-box riboswitch

Menendez AM, Nesbitt DJThermodynamic compensation to temperature extremes in B. subtilis vs T. maritima lysine riboswitches.Biophysical journal. 2024 Jul 31; . PMID: 39091026
Sung HL, Nesbitt DJSynergism in the Molecular Crowding of Ligand-Induced Riboswitch Folding: Kinetic/Thermodynamic Insights from Single-Molecule Spectroscopy.The journal of physical chemistry. B. 2022 Aug 18; . PMID: 35981263
Marton Menendez A, Nesbitt DJLysine-Dependent Entropy Effects in the B. subtilis Lysine Riboswitch: Insights from Single-Molecule Thermodynamic Studies.The journal of physical chemistry. B. 2021 Dec 27; . PMID: 34958583
Sun Y, Wang Y, Tan ZJ, Zhang W Regulation mechanism of lysC riboswitch in Gram-positive bacterium Bacillus subtilis. Journal of biomolecular structure & dynamics. 2019 Jul 03; :1-11. doi:10.1080/07391102.2019.1639546. PMID:31267846
McCluskey K, Boudreault J, St-Pierre P, Perez-Gonzalez C, Chauvier A, Rizzi A, Beauregard PB, Lafontaine DA, Penedo JC Unprecedented tunability of riboswitch structure and regulatory function by sub-millimolar variations in physiological Mg2. Nucleic acids research. 2019 May 02; . pii:gkz316. doi:10.1093/nar/gkz316. PMID:31045204
Fiegland LR, Garst AD, Batey RT, Nesbitt DJ Single-molecule studies of the lysine riboswitch reveal effector-dependent conformational dynamics of the aptamer domain. Biochemistry. 2012 Nov 13; 51(45):9223-33. doi:10.1021/bi3007753. PMID:23067368
Wilson-Mitchell SN, Grundy FJ, Henkin TM Analysis of lysine recognition and specificity of the Bacillus subtilis L box riboswitch. Nucleic acids research. 2012 Jul; 40(12):5706-17. doi:10.1093/nar/gks212. PMID:22416067
Blouin S, Chinnappan R, Lafontaine DA Folding of the lysine riboswitch: importance of peripheral elements for transcriptional regulation. Nucleic acids research. 2011 Apr; 39(8):3373-87. doi:10.1093/nar/gkq1247. PMID:21169337
Phan TT, Schumann W Transcriptional analysis of the lysine-responsive and riboswitch-regulated lysC gene of Bacillus subtilis. Current microbiology. 2009 Oct; 59(4):463-8. doi:10.1007/s00284-009-9461-4. PMID:19636616
Kato C, Kurihara T, Kobashi N, Yamane H, Nishiyama M Conversion of feedback regulation in aspartate kinase by domain exchange. Biochemical and biophysical research communications. 2004 Apr 09; 316(3):802-8. . PMID:15033471
Sudarsan N, Wickiser JK, Nakamura S, Ebert MS, Breaker RR An mRNA structure in bacteria that controls gene expression by binding lysine. Genes & development. 2003 Nov 01; 17(21):2688-97. . PMID:14597663
Grundy FJ, Lehman SC, Henkin TM The L box regulon: lysine sensing by leader RNAs of bacterial lysine biosynthesis genes. Proceedings of the National Academy of Sciences of the United States of America. 2003 Oct 14; 100(21):12057-62. . PMID:14523230