spoIIIE

168

ATP-dependent dsDNA translocase, resolution of chromosomal dimers after DNA replication, coordinates chromosome segregation and peptidoglycan remodeling during sporulation, transports the forespore chromosome across the sporulation septum

Locus: BSU_16800

Molecular weight: 86.96 kDa

Isoelectric point: 6.76

Protein length: 789 aa

Gene length: 2370 bp

Function: chromosome partition during sporulation

Product: ATP-dependent dsDNA translocase required for chromosome partition

Essential: no

Synonyms: spoIIIE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1674 (Galperin et al., 2021)

Gene

Coordinates: 1,752,272  1,754,641

The protein

Catalyzed reaction/ biological activity

• transports the forespore chromosome across the sporulation septum PubMed
• translocates septum-entrapped DNA only when septum closure precedes complete segregation of chromosomes PubMed
• the two DNA translocases SftA and SpoIIIE synergistically affect chromosome dimer resolution presumably by positioning the dif sites in close proximity, before or after completion of cell division, respectively PubMed
• binds DNA sequences named SRS for SpoIIIE recognition sequence, GAGAAGGG PubMed

Protein family

• FtsK/SpoIIIE/SftA family (with SftA, according to UniProt)

Domains

• N-terminal transmembrane domain (4 helices) PubMed
• 134 aa linker PubMed
• 512 aa motor domain at the C-terminus PubMed
• FtsK domain (aa 450-646) (according to UniProt)

Structure

• 2IUT (PDB) (FtsK from Pseudomonas aeruginosa, partial, 48% identity, complex with SftA) PubMed
• P21458 (AlphaFold)

Paralogous protein(s)

• SftA

Localization

• free diffusion in the membrane, no enrichment at septa PubMed
• transmembrane domain mediates dynamic localization to active division sites PubMed
• complexes are recruited to nascent sites of septation, and are subsequently escorted by the constriction machinery to the center of sporulation and division septa PubMed
• anchored at the edge of a septal pore, stabilized by newly synthesized peptidoglycan and protein-protein interactions across the septum PubMed

Expression and Regulation

Operons

• Genes: spoIIIE-ymfC

  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• BKE16800 (spoIIIE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACACTCATCACCTTACTGC,  downstream forward: _UP4_TAATGAAGGGAGTTCCGCTT
• BKK16800 (spoIIIE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACACTCATCACCTTACTGC,  downstream forward: _UP4_TAATGAAGGGAGTTCCGCTT

References

Reviews

Loading

Original Publications

Loading