yqcG

yqcG
168

LXG toxin, eliminates defective cells from developing biofilms, RNase activity

locus
BSU_25860
Molecular weight
59.50 kDa
pI
8.81
Protein length
Gene length
function
eliminates defective cells from developing biofilms
product
LXG toxin, RNase
essential
yes
synonyms
yqcG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5444 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,661,102 → 2,662,697
Phenotypes of a mutant
the mutant is outcompeted by wild type cells in biofilms [pubmed|34280190]
The protein
Catalyzed reaction/ biological activity
part of a type II toxin/antitoxin system (with [protein|1E12F7A40992AE240568A0E8A0EA4F6BBDECF142|yqcF]) [Pubmed|27450630]
eliminates defective cells from developing biofilms [Pubmed|27450630]
DNA degradation [Pubmed|25922388]
[wiki|Domains]
[wiki|LXG domain] (aa 1-235) (according to UniProt)
Structure
[AF|P45942]
[wiki|Localization]
secreted
secretion and delivery requires [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|WXG100] and the T7SS ([protein|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[protein|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|essB]-[wiki|YukB]-[wiki|YueB]-[wiki|YueC]-[protein|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]) [pubmed|34280190]
Expression and Regulation
Operons
genes
[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]-[gene|1E12F7A40992AE240568A0E8A0EA4F6BBDECF142|yqcF]
description
[Pubmed|22383849]
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]→[gene|1E12F7A40992AE240568A0E8A0EA4F6BBDECF142|yqcF]

2025-10-25 15:36:14

ghost

153

91bea327e616f9c07dd9472b5c9585cac0ec129c

B48790D4F118FF6CD742E08C9101289F9EAB3043

Biological materials
Mutant
BKE25860 (Δ[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCATATCCTTTCATT,  downstream forward: _UP4_GGAGATTAAGGAGAGATTGT
BKK25860 (Δ[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCATATCCTTTCATT,  downstream forward: _UP4_GGAGATTAAGGAGAGATTGT
References
14651647,25922388,22200572,23033921,20817675,27450630,34280190

D828A8E03C894D1082EFCB11BEF1384F04D17ECA

Page visits: 5591

Time of last update: 2025-10-27 18:24:08

Author of last update: Jstuelk