pnpA

168

polynucleotide phosphorylase, RNase, contributes to efficient 3' exonucleolytic mRNA decay (together with CshA), involved in double-strand break repair

Locus: BSU_16690

Molecular weight: 77.28 kDa

Isoelectric point: 4.89

Protein length: 705 aa

Gene length: 2118 bp

Function: DNA repair, competence development, RNA degradation

Product: polynucleotide phosphorylase (PNPase)

Essential: no

E.C.: 2.7.7.8

Synonyms: pnpA, comR, pnp

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1185 (Galperin et al., 2021)

Gene

Coordinates: 1,739,383 1,741,500

Phenotypes of a mutant

• The pnpA mutant is cold sensitive and sensitive to tetracyclin, it shows multiseptate filamentous growth PubMed
• The mutant is deficient in genetic competence (no expression of the late competence genes) PubMed
• The pnpA mutant exhibits reduced motility and reduced expression of the fla-che operon resulting from accumulation of slrA mRNA PubMed
• The mutant overexpresses the trp and ''putB-putC-putP'' operons
• defective in Swarming motility PubMed

The protein

Catalyzed reaction/ biological activity

• 3'-5' exoribonuclease, RNase
• PNPase degrades the trp mRNA from RNA-TRAP complex
• degradation of the SlrA mRNA from the 3' end, through the Rho-dependent terminator PubMed
• involved in double-strand break (DSB) repair via homologous recombination (HR) or non-homologous end-joining (NHEJ) PubMed
• degrades ssDNA (3' - 5') (stimulated by RecA, inhibited by SsbA) PubMed
• can polymerize ssDNA at a free 3' OH end, stimulated by RecN PubMed
• phosphate + RNA_(n+1) --> ribonucleoside 5'-diphosphate + RNA_(n) (according to UniProt)

Protein family

• polyribonucleotide nucleotidyltransferase family (single member, according to UniProt)

Domains

• KH domain (aa 554-613) (according to UniProt)
• S1 domain (aa 623-691) (according to UniProt)

Structure

• 5YJJ (PDB) (protein from Staphylococcus aureus) PubMed
• 3GCM (PDB) (protein from E. coli, PNPase/RNase E micro-domain/RNA tetragonal crystal form )
• P50849 (AlphaFold)

Localization

• cytoplasm (homogeneous) PubMed

Additional information

• required for the expression of late competence genes comGA and comK, requirement bypassed by a mecA disruption; may be necessary for modification of the srfAA transcript (stabilization or translation activation)
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: pnpA

  Description: PubMed

  Regulation

  • Rel dependent downregulation (Class I) during stringent response PubMed

  Regulatory mechanism

  • stringent response: negative regulation, in stringent response

Biological materials

Mutant

• GP1748 (ΔpnpA::aphA3), available in Jörg Stülke's lab, PubMed
• BKE16690 (pnpA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACAATTACGAACTCCTC, downstream forward: _UP4_TAAATGAAAACATAAAAGGA
• BKK16690 (pnpA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACAATTACGAACTCCTC, downstream forward: _UP4_TAAATGAAAACATAAAAGGA

Expression vectors

• for expression, purification in E. coli with N-terminal His-tag, in pWH844: pGP838, available in Jrg Stlke's lab
• for expression/ purification from B. subtilis with N-terminal Strep-tag, for SPINE, in pGP380: pGP1342, available in Jrg Stlke's lab
• for chromosomal expression of PnpA-Strep (cat): GP1002, available in Jrg Stlke's lab
• for chromosomal expression of PnpA-Strep (spc): GP1038, available in Jrg Stlke's lab
• pGP1439: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jrg Stlke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jrg Stlke's lab, PubMed

FLAG-tag construct

• GP1021 (spc, based on pGP1331) PubMed, available in Jrg Stlke's lab
• GP1076 (ermC) PubMed, available in Jrg Stlke's lab

GFP fusion

• GP1698 (in pBP43), expression of pnpA-GFP::spc under the native promoter, available in Jrg Stlke's lab PubMed

Labs working on this gene/protein

• David Bechhofer, Mount Sinai School, New York, USA Laboratories and Programs/Bechhofer Laboratory?citype=Physician&ciid=Bechhofer David H 1255565 Homepage

References

Reviews

Bechhofer DH, Deutscher MP Bacterial ribonucleases and their roles in RNA metabolism. Critical reviews in biochemistry and molecular biology. 2019 Jun; 54(3):242-300. doi:10.1080/10409238.2019.1651816. PMID:31464530
Dos Santos RF, Quendera AP, Boavida S, Seixas AF, Arraiano CM, Andrade JM Major 3'-5' Exoribonucleases in the Metabolism of Coding and Non-coding RNA. Progress in molecular biology and translational science. 2018; 159:101-155. pii:S1877-1173(18)30098-X. doi:10.1016/bs.pmbts.2018.07.005. PMID:30340785
Durand S, Condon C RNases and Helicases in Gram-Positive Bacteria. Microbiology spectrum. 2018 Apr; 6(2). doi:10.1128/microbiolspec.RWR-0003-2017. PMID:29651979
Campos Guillen J, Jones GH, Saldaña Gutiérrez C, Hernández-Flores JL, Cruz Medina JA, Valenzuela Soto JH, Pacheco Hernández S, Romero Gómez S, Morales Tlalpan V Critical Minireview: The Fate of tRNA(Cys) during Oxidative Stress in Bacillus subtilis. Biomolecules. 2017 Jan 20; 7(1). pii:E6. doi:10.3390/biom7010006. PMID:28117687
Deutscher MP How bacterial cells keep ribonucleases under control. FEMS microbiology reviews. 2015 May; 39(3):350-61. doi:10.1093/femsre/fuv012. PMID:25878039
Hui MP, Foley PL, Belasco JG Messenger RNA degradation in bacterial cells. Annual review of genetics. 2014; 48:537-59. doi:10.1146/annurev-genet-120213-092340. PMID:25292357
Gerwig J, Stülke J Caught in the act: RNA-Seq provides novel insights into mRNA degradation. Molecular microbiology. 2014 Oct; 94(1):5-8. doi:10.1111/mmi.12769. PMID:25155548
Lehnik-Habrink M, Lewis RJ, Mäder U, Stülke J RNA degradation in Bacillus subtilis: an interplay of essential endo- and exoribonucleases. Molecular microbiology. 2012 Jun; 84(6):1005-17. doi:10.1111/j.1365-2958.2012.08072.x. PMID:22568516
Andrade JM, Pobre V, Silva IJ, Domingues S, Arraiano CM The role of 3'-5' exoribonucleases in RNA degradation. Progress in molecular biology and translational science. 2009; 85:187-229. doi:10.1016/S0079-6603(08)00805-2. PMID:19215773
Lin-Chao S, Chiou NT, Schuster G The PNPase, exosome and RNA helicases as the building components of evolutionarily-conserved RNA degradation machines. Journal of biomedical science. 2007 Jul; 14(4):523-32. . PMID:17514363
Sarkar D, Fisher PB Polynucleotide phosphorylase: an evolutionary conserved gene with an expanding repertoire of functions. Pharmacology & therapeutics. 2006 Oct; 112(1):243-63. . PMID:16733069
Carpousis AJ, Vanzo NF, Raynal LC mRNA degradation. A tale of poly(A) and multiprotein machines. Trends in genetics : TIG. 1999 Jan; 15(1):24-8. . PMID:10087930

Original Publications

Haq IU, Müller P, Brantl SA comprehensive study of the interactions in the B. subtilis degradosome with special emphasis on the role of the small proteins SR1P and SR7P.Molecular microbiology. 2023 Nov 22; . PMID: 37994189
Sanchez S, Snider EV, Wang X, Kearns DBIdentification of Genes Required for Swarming Motility in Bacillus subtilis Using Transposon Mutagenesis and High-Throughput Sequencing (TnSeq).Journal of bacteriology. 2022 Jun 21; 204(6):e0008922. PMID: 35638827
Chhabra S, Mandell ZF, Liu B, Babitzke P, Bechhofer DHAnalysis of mRNA Decay Intermediates in Bacillus subtilis 3' Exoribonuclease and RNA Helicase Mutant Strains.mBio. 2022 Mar 21; :e0040022. PMID: 35311531
Oviedo-Bocanegra LM, Hinrichs R, Rotter DAO, Dersch S, Graumann PLSingle molecule/particle tracking analysis program SMTracker 2.0 reveals different dynamics of proteins within the RNA degradosome complex in Bacillus subtilis.Nucleic acids research. 2021 Aug 20; . PMID: 34417617
Durand S, Callan-Sidat A, McKeown J, Li S, Kostova G, Hernandez-Fernaud JR, Alam MT, Millard A, Allouche D, Constantinidou C, Condon C, Denham ELIdentification of an RNA sponge that controls the RoxS riboregulator of central metabolism in Bacillus subtilis.Nucleic acids research. 2021 Jun 7; . PMID: 34096591
Ingle S, Chhabra S, Laspina D, Salvo E, Liu B, Bechhofer DHPolynucleotide phosphorylase and RNA helicase CshA cooperate in Bacillus subtilis mRNA decay.RNA biology. 2020 Dec 16; . PMID: 33323028
Campos Guillén J, Arvizu Gómez JL, Jones GH, Hernández Flores JL, Ramos López MA, Cruz Hernández A, Romero Gómez S Analysis of tRNA processing in the absence of CCAase in Bacillus subtilis. Brazilian journal of microbiology : [publication of the Brazilian Society for Microbiology]. 2019 Apr 12; . doi:10.1007/s42770-019-00075-5. PMID:31041723
Raj R, Mitra S, Gopal B Characterization of Staphylococcus epidermidis Polynucleotide phosphorylase and its interactions with ribonucleases RNase J1 and RNase J2. Biochemical and biophysical research communications. 2018 Jan 08; 495(2):2078-2084. pii:S0006-291X(17)32450-6. doi:10.1016/j.bbrc.2017.12.056. PMID:29242153
de Jong L, de Koning EA, Roseboom W, Buncherd H, Wanner MJ, Dapic I, Jansen PJ, van Maarseveen JH, Corthals GL, Lewis PJ, Hamoen LW, de Koster CG In-Culture Cross-Linking of Bacterial Cells Reveals Large-Scale Dynamic Protein-Protein Interactions at the Peptide Level. Journal of proteome research. 2017 Jul 07; 16(7):2457-2471. doi:10.1021/acs.jproteome.7b00068. PMID:28516784
Stone CM, Butt LE, Bufton JC, Lourenco DC, Gowers DM, Pickford AR, Cox PA, Vincent HA, Callaghan AJ Inhibition of homologous phosphorolytic ribonucleases by citrate may represent an evolutionarily conserved communicative link between RNA degradation and central metabolism. Nucleic acids research. 2017 Mar 03; . doi:10.1093/nar/gkx114. PMID:28334892
Huen J, Lin CL, Golzarroshan B, Yi WL, Yang WZ, Yuan HS Structural Insights into a Unique Dimeric DEAD-Box Helicase CshA that Promotes RNA Decay. Structure (London, England : 1993). 2017 Mar 07; 25(3):469-481. pii:S0969-2126(17)30012-6. doi:10.1016/j.str.2017.01.012. PMID:28238534
Cascante-Estepa N, Gunka K, Stülke J Localization of Components of the RNA-Degrading Machine in Bacillus subtilis. Frontiers in microbiology. 2016; 7:1492. . PMID:27708634
Liu B, Kearns DB, Bechhofer DH Expression of multiple Bacillus subtilis genes is controlled by decay of slrA mRNA from Rho-dependent 3' ends. Nucleic acids research. 2016 Apr 20; 44(7):3364-72. doi:10.1093/nar/gkw069. PMID:26857544
Salvo E, Alabi S, Liu B, Schlessinger A, Bechhofer DH Interaction of Bacillus subtilis Polynucleotide Phosphorylase and RNase Y: STRUCTURAL MAPPING AND EFFECT ON mRNA TURNOVER. The Journal of biological chemistry. 2016 Mar 25; 291(13):6655-63. doi:10.1074/jbc.M115.711044. PMID:26797123
Liu B, Deikus G, Bree A, Durand S, Kearns DB, Bechhofer DH Global analysis of mRNA decay intermediates in Bacillus subtilis wild-type and polynucleotide phosphorylase-deletion strains. Molecular microbiology. 2014 Oct; 94(1):41-55. doi:10.1111/mmi.12748. PMID:25099370
Cruz Hernández A, Millan ES, de Jesús Romero Gómez S, Antonio Cervantes Chávez J, Garcia Martínez R, Pastrana Martínez X, Gómez JL, Jones GH, Guillén JC Exposure of Bacillus subtilis to mercury induces accumulation of shorter tRNA Cys species. Metallomics : integrated biometal science. 2013 Apr; 5(4):398-403. doi:10.1039/c3mt20203h. PMID:23529473
Newman JA, Hewitt L, Rodrigues C, Solovyova AS, Harwood CR, Lewis RJ Dissection of the network of interactions that links RNA processing with glycolysis in the Bacillus subtilis degradosome. Journal of molecular biology. 2012 Feb 10; 416(1):121-36. doi:10.1016/j.jmb.2011.12.024. PMID:22198292
Deikus G, Bechhofer DH 5' End-independent RNase J1 endonuclease cleavage of Bacillus subtilis model RNA. The Journal of biological chemistry. 2011 Oct 07; 286(40):34932-40. doi:10.1074/jbc.M111.287409. PMID:21862575
Cardenas PP, Carzaniga T, Zangrossi S, Briani F, Garcia-Tirado E, Dehò G, Alonso JC Polynucleotide phosphorylase exonuclease and polymerase activities on single-stranded DNA ends are modulated by RecN, SsbA and RecA proteins. Nucleic acids research. 2011 Nov; 39(21):9250-61. doi:10.1093/nar/gkr635. PMID:21859751
Lehnik-Habrink M, Newman J, Rothe FM, Solovyova AS, Rodrigues C, Herzberg C, Commichau FM, Lewis RJ, Stülke J RNase Y in Bacillus subtilis: a Natively disordered protein that is the functional equivalent of RNase E from Escherichia coli. Journal of bacteriology. 2011 Oct; 193(19):5431-41. doi:10.1128/JB.05500-11. PMID:21803996
Lehnik-Habrink M, Pförtner H, Rempeters L, Pietack N, Herzberg C, Stülke J The RNA degradosome in Bacillus subtilis: identification of CshA as the major RNA helicase in the multiprotein complex. Molecular microbiology. 2010 Aug; 77(4):958-71. doi:10.1111/j.1365-2958.2010.07264.x. PMID:20572937
Yao S, Bechhofer DH Initiation of decay of Bacillus subtilis rpsO mRNA by endoribonuclease RNase Y. Journal of bacteriology. 2010 Jul; 192(13):3279-86. doi:10.1128/JB.00230-10. PMID:20418391
Campos-Guillén J, Arvizu-Gómez JL, Jones GH, Olmedo-Alvarez G Characterization of tRNA(Cys) processing in a conditional Bacillus subtilis CCase mutant reveals the participation of RNase R in its quality control. Microbiology (Reading, England). 2010 Jul; 156(Pt 7):2102-11. doi:10.1099/mic.0.034652-0. PMID:20360175
Deikus G, Bechhofer DH Bacillus subtilis trp Leader RNA: RNase J1 endonuclease cleavage specificity and PNPase processing. The Journal of biological chemistry. 2009 Sep 25; 284(39):26394-401. doi:10.1074/jbc.M109.015875. PMID:19638340
Yao S, Bechhofer DH Processing and stability of inducibly expressed rpsO mRNA derivatives in Bacillus subtilis. Journal of bacteriology. 2009 Sep; 191(18):5680-9. doi:10.1128/JB.00740-09. PMID:19633085
Cardenas PP, Carrasco B, Sanchez H, Deikus G, Bechhofer DH, Alonso JC Bacillus subtilis polynucleotide phosphorylase 3'-to-5' DNase activity is involved in DNA repair. Nucleic acids research. 2009 Jul; 37(12):4157-69. doi:10.1093/nar/gkp314. PMID:19433509
Commichau FM, Rothe FM, Herzberg C, Wagner E, Hellwig D, Lehnik-Habrink M, Hammer E, Völker U, Stülke J Novel activities of glycolytic enzymes in Bacillus subtilis: interactions with essential proteins involved in mRNA processing. Molecular & cellular proteomics : MCP. 2009 Jun; 8(6):1350-60. doi:10.1074/mcp.M800546-MCP200. PMID:19193632
Campos-Guillén J, Bralley P, Jones GH, Bechhofer DH, Olmedo-Alvarez G Addition of poly(A) and heteropolymeric 3' ends in Bacillus subtilis wild-type and polynucleotide phosphorylase-deficient strains. Journal of bacteriology. 2005 Jul; 187(14):4698-706. . PMID:15995184
Oussenko IA, Abe T, Ujiie H, Muto A, Bechhofer DH Participation of 3'-to-5' exoribonucleases in the turnover of Bacillus subtilis mRNA. Journal of bacteriology. 2005 Apr; 187(8):2758-67. . PMID:15805522
Eymann C, Dreisbach A, Albrecht D, Bernhardt J, Becher D, Gentner S, Tam le T, Büttner K, Buurman G, Scharf C, Venz S, Völker U, Hecker M A comprehensive proteome map of growing Bacillus subtilis cells. Proteomics. 2004 Oct; 4(10):2849-76. . PMID:15378759
Deikus G, Babitzke P, Bechhofer DH Recycling of a regulatory protein by degradation of the RNA to which it binds. Proceedings of the National Academy of Sciences of the United States of America. 2004 Mar 02; 101(9):2747-51. . PMID:14976255
Eymann C, Homuth G, Scharf C, Hecker M Bacillus subtilis functional genomics: global characterization of the stringent response by proteome and transcriptome analysis. Journal of bacteriology. 2002 May; 184(9):2500-20. . PMID:11948165
Farr GA, Oussenko IA, Bechhofer DH Protection against 3'-to-5' RNA decay in Bacillus subtilis. Journal of bacteriology. 1999 Dec; 181(23):7323-30. . PMID:10572137
Bechhofer DH, Wang W Decay of ermC mRNA in a polynucleotide phosphorylase mutant of Bacillus subtilis. Journal of bacteriology. 1998 Nov; 180(22):5968-77. . PMID:9811656
Luttinger A, Hahn J, Dubnau D Polynucleotide phosphorylase is necessary for competence development in Bacillus subtilis. Molecular microbiology. 1996 Jan; 19(2):343-56. . PMID:8825779
Mitra S, Hue K, Bechhofer DH In vitro processing activity of Bacillus subtilis polynucleotide phosphorylase. Molecular microbiology. 1996 Jan; 19(2):329-42. . PMID:8825778
Wang W, Bechhofer DH Properties of a Bacillus subtilis polynucleotide phosphorylase deletion strain. Journal of bacteriology. 1996 Apr; 178(8):2375-82. . PMID:8636041
Deutscher MP, Reuven NB Enzymatic basis for hydrolytic versus phosphorolytic mRNA degradation in Escherichia coli and Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 1991 Apr 15; 88(8):3277-80. . PMID:1707536

PNPase in ''E. coli

Nurmohamed S, Vincent HA, Titman CM, Chandran V, Pears MR, Du D, Griffin JL, Callaghan AJ, Luisi BF Polynucleotide phosphorylase activity may be modulated by metabolites in Escherichia coli. The Journal of biological chemistry. 2011 Apr 22; 286(16):14315-23. doi:10.1074/jbc.M110.200741. PMID:21324911
Nurmohamed S, Vaidialingam B, Callaghan AJ, Luisi BF Crystal structure of Escherichia coli polynucleotide phosphorylase core bound to RNase E, RNA and manganese: implications for catalytic mechanism and RNA degradosome assembly. Journal of molecular biology. 2009 May 29; 389(1):17-33. doi:10.1016/j.jmb.2009.03.051. PMID:19327365
Del Favero M, Mazzantini E, Briani F, Zangrossi S, Tortora P, Dehò G Regulation of Escherichia coli polynucleotide phosphorylase by ATP. The Journal of biological chemistry. 2008 Oct 10; 283(41):27355-9. doi:10.1074/jbc.C800113200. PMID:18650428