rel

168

GTP pyrophosphokinase (stringent response regulon)

Locus: BSU_27600

Molecular weight: 84.65 kDa

Isoelectric point: 6.96

Protein length: 734 aa

Gene length: 2205 bp

Function: synthesis and degradation of (p)ppGpp, triggering the stringent response regulon

Product: GTP pyrophosphokinase

Essential: no

E.C.: 2.7.6.5

Synonyms: relA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0317 (Galperin et al., 2021)

Gene

Coordinates: 2,820,529 → 2,822,733

Phenotypes of a mutant

• requirement for valine PubMed
• a rel sasA sasB triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of guaB or inactivation of codY PubMed
• a rel sasA sasB triple mutant acquires suppressor mutations in guaA, guaB, gmk or inactivation of codY PubMed
• a rel sasA sasB triple mutant is unable to grow in the presence of guanosine, this can be suppressed by inactivation of pyk, hprT, or gmk PubMed
• mutation in rel results in increased motility and chaining via elevated SigD level  PubMed

The protein

Catalyzed reaction/ biological activity

• ATP + GTP --> AMP + pppGpp (according to UniProt)

Protein family

• RelA/SpoT family (with SasA and SasB, according to UniProt)

Domains

• N-terminal ppGpp hydrolase domain (HD domain) (aa 31-180) PubMed
• central ppGpp synthetase domain PubMed
• TGS domain (aa 392-453) (according to UniProt)
• C-terminal ACT domain (aa 660-734) (responsible for fine-tuning of activation at the ribosome) PubMed

Structure

• 6YXA (PDB) (aa 1 ... 556) PubMed
• 6HTQ (PDB) (the Rel-ribosome complex) PubMed
• 8ACU (PDB) (the DarB₂-Rel^NTD₂ complex) PubMed
• 1VJ7 (PDB) (N-terminal catalytic fragment, from Streptococcus equisimilis, 60% identity) PubMed
• O54408 (AlphaFold)

Effectors of protein activity

• (p)ppGpp synthesis is activated by uncharged tRNAs in a ribosome-dependent manner PubMed
• synthetase activity of RelA is activated by pppGpp binding to an allosteric site in the NTD region PubMed
• hydrolase activity of ReAl is inhibited by (p)ppGpp PubMed
• the interaction with ComGA inhibits the hydrolysis of ppGpp PubMed
• heat stress triggers (p)ppGpp synthesis PubMed
• the presence of immature tRNAs due to depletion of RNase P or RNase Z triggers (p)ppGpp synthesis by Rel PubMed
• interaction with apo-DarB (under conditions of potassium starvation) triggers (p)ppGpp synthesis and inhibits (p)ppGpp hydrolysis PubMed

Expression and Regulation

Operons

• Genes: rel-dtd

  Description: PubMed

Biological materials

Mutant

• rel mutant PubMed - note that rel mutants are prone to suppressor mutations in the sasA or sasB loci PubMed
• GP2066 (sasA sasB rel::mls), available in Jörg Stülke's lab
• BKE27600 (Δrel::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
• BKK27600 (Δrel::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
• GP3419 (Δrel::cat) , available in Jörg Stülke's lab
• GP3471 (ΔsasA::spec Δrel::cat), available in Jörg Stülke's lab
• GP3472 (Δrel::cat ΔsasB::phleo), available in Jörg Stülke's lab
• GP3429 (rel-6xHis-cat), available in Jörg Stülke's lab

Expression vectors

• pGP3330 (N-terminal 6xHis-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab
• pGP3459 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in Jörg Stülke's lab
• pGP3348 (N-terminal Strep-tag, purification from E. coli, in pGP172), available in Jörg Stülke's lab
• pGP3350 (aa 1-391) (N-terminal Strep-tag, purification from E. coli, in pGP172), available in Jörg Stülke's lab
• pGP3430: expression of Strep-rel by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3431: expression of rel-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Labs working on this gene/protein

• Jade Wang, University of Wisconsin–Madison homepage

References

Reviews

Loading

Original Publications

Loading